Answer:
C, carbon dioxide and water
I thought it was (d) but I might be wrong
Answer:
Insulin regulates blood glucose levels
Answer:
antibiotics
Explanation:
pesticides have to do with nature and killing bugs, weeds, etc. Irrigation has to do with watering plants and people. Trucks are vehicles that transport. Antiobiotics help kill bad bacteria in your body when your sick, so that's health related.
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved