1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
daser333 [38]
3 years ago
14

In seals, the gene for the length of the whiskers has two alleles. The dominant allele (A) codes long whiskers and the recessive

allele (a) codes for short whiskers. What percentage of offspring would be expected to have short whiskers from the cross of two long whiskered seals, one that is homozygous dominant and one that is heterozygous?
This is a punter square problem
Biology
1 answer:
stepan [7]3 years ago
4 0

I would say,

Aa.

Please mark brainlist.

And sorry for the user below ..☺☻

You might be interested in
Need help figuring this out! Am having a bit of trouble with it
Nataliya [291]

Explanation:

BB=Brown as both are big B's

Bb=Brown as there is a big B

bb=Blue as both are little b's

5 0
3 years ago
Consider the stage of cellular respiration that is shown in the diagram.
ELEN [110]

I wanna say D, but I’m not entirely sure

6 0
3 years ago
Energy enters most ecosystems as sunlight. Within an ecosystem, energy is transformed, used, and exits the ecosystem as heat. Dr
postnew [5]
Could you put the terms ???
4 0
2 years ago
What organelle is found in animal cells but NOT in plant cells?
Dovator [93]

Centrioles is only found in animal cells but not in plant cells.

6 0
3 years ago
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Other questions:
  • which list shows the levels of organization in hierarchical order from left to right feom the smallest to the most complex
    10·1 answer
  • A controversial diagnosis for a person who exhibits two or more distinct personalities is:
    9·1 answer
  • Aquatic organisms are able to survive when the temperature decreases. These organisms survive even when the surfaces of lakes an
    13·1 answer
  • How do you write the phenotype for two heterozygous purple corn kernels
    10·1 answer
  • What time frame is considered rapid environmental change?
    9·1 answer
  • Choose the combination of factors that creates snow.
    9·1 answer
  • D.amn it's annoying while answering everytime​
    6·1 answer
  • Identify the source of the energy that flows through the field ecosystem.
    10·1 answer
  • Help! Which viral reproduction cycle only creates new infected host cells?
    10·1 answer
  • Define the term GOD cell.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!