1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Vikki [24]
4 years ago
7

The celestial body at the center of the solar system is a large ball of gases, mostly made up of helium and hydrogen. The hydrog

en in this celestial body undergoes nuclear fusion, thus producing helium
Biology
1 answer:
snow_tiger [21]4 years ago
7 0
The answer would be the sun or more generally, a star
You might be interested in
Question 16
monitta

Answer:

D

the skeletal system provides protection for the brain and spinal cord

3 0
3 years ago
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of
GaryK [48]

Answer:

dragon warrior or whatever it is called I don't maybe I am right

4 0
3 years ago
In a population of Mendel's garden peas, the frequency of the dominant A (yellow flower) allele is 80%. Let p represent the freq
DENIUS [597]

Answer:

If the frequency of the dominant allele in the pea population is 0.8, the genotype frequencies in the population would be 0.64 AA, 0.32 Aa, and 0.04 aa.

Explanation:

Hardy-Weinberg equation tells us that:

p2 + 2pq + q2

p2 is the frequency of AA plants

2pq is the frequency of Aa plants, and

q2 the frequency of aa individuals.

A allele in the population is 80%, the frequency is 0.8.

p represent the frequency of A allele. p is 0.8

Therefore calculating for q ( frequency of a allele).

p + q = 1.0

q = 1.0 − p

q = 1.0 − 0.8

q = 0.2

p = 0.8, q = 0.2.

Now we can calculate the predicted frequencies of the different genotypes, remembering that p2 is the frequency of the AA genotype, 2pq is the frequency of the Aa genotype, and q2 the frequency of aa genotype.

p2 = 0.8 x 0.8 = 0.64

2pq = 2 x 0.8 x 0.2 = 0.32

q2 = 0.2 x 0.2 = 0.04.

Thus, we would expect to see genotype frequencies of 0.64 AA, 0.32 Aa, and 0.04 aa in the pea plants.

6 0
3 years ago
Mary has type A blood and her husband (John) has type B blood. John's parents both had type AB. Mary and John have three childre
Mamont248 [21]
The one that said AB was addoptes
8 0
3 years ago
Energy was added to the molecule. What processes would occur in the cell to add this energy?
lisov135 [29]
In order for energy to be able to be created, ATP(adenosine triphosphate) needs to form in either photosynthesis or krebs cycle from ADP + P(from NADPH). When ATP is available, huge amounts of energy are released when needed by slicing one P atom from ATP So that it can again become ADP and undergo lots of processes to become ATP again. So energy is added from tearing of Phosphate Atom due to tearing of phosphoanhydride bonds. This is possible because of process known as hydrolysis, when ATP is in equilibrium with water and some electrons. And the process of ADP becoming ATP is recharging and occurs in mitochondria.

The processes are hydrolysis and rechargeation, but most important process is Krebs Cycle, where all of this happens.
4 0
3 years ago
Other questions:
  • Which process produces human egg and sperm cells?
    6·2 answers
  • What does selectively permeable mean? (1 point)
    8·1 answer
  • Here’s a free question with out the work! Just thought someone might like some free point or something :)
    7·2 answers
  • Proper folding of proteins is essential for their biological activity. In general, the functional conformation of a protein is t
    5·1 answer
  • In the reaction 6CO2 + 6H2O → C6H12O6 + 6O2 carbon dioxide is one of the
    8·1 answer
  • Please help me, i will mark u brainliest if it is correct :)
    8·1 answer
  • In an earthworm is the dorsal blood vessel or the ventral blood vessel larger?
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Helppp hah im stuck with this
    10·2 answers
  • Which of the following abiotic factors might have an effect on how much photosynthesis can occur by the producers in an ecosyste
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!