1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Katyanochek1 [597]
3 years ago
10

Bodily energy Taoists cultivate within themselves is called:

Biology
1 answer:
Anna71 [15]3 years ago
4 0

Answer:

The correct answer is - D. Chi.

Explanation:

Taoist is a Chinese origin tradition that is spiritual and philosophical and focuses on living in harmony with, the source, patter, and substance of everything exists called Tao.

They believe that Chi is the bodily energy one needs to cultivate within oneself it is known as the energy of life and it translates as cultivation of energy. One can cultivate by relaxing and focusing on the body, abdominal breathing, connect to the earth and believe in chi.

You might be interested in
How are limestone and shells connected to the carbon cycle plz answer and fast
noname [10]
Limestone contains calcium carbonate which comes from animals that have shells, it already has carbon. Other sources are ocean animals which create shells that combine both carbon and calcium. Their dead bodies also release carbon to the ocean. Limestone is also known as a sedimentary rock that has carbon. Outside the ocean, limestone emits the carbon and becomes part of the carbon cycle. In addition to this, limestones are widely used by people becomes a part of the carbon cycle. Its component is present on asphalt, animal feed.
5 0
4 years ago
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Which is an example of a structural adaptation of a lion?
Kruka [31]
Its most likely B because its Skeleton is its structure (?)
6 0
4 years ago
Read 2 more answers
1.increasing heart rate raised the blood delivery of the body<br> True or false
Masteriza [31]
True
because ur hart pumps faster and then blood flow increases and the you have more blood delivery to your body
5 0
3 years ago
In the fall leaves being to turn different colors because
r-ruslan [8.4K]

Chlorophyll breaks down.

7 0
3 years ago
Read 2 more answers
Other questions:
  • What happens to the egg follicle in the ovary as fsh rises
    15·1 answer
  • Please answer :D
    15·2 answers
  • What is the element of an atom that has six protons and six electrons
    8·1 answer
  • Can someone please help me I need the answer and don’t understand? Thanks
    13·1 answer
  • GenAlex Medical, a leading manufacturer of medical laboratory equipment, is designing a new automated system that can detect bor
    12·1 answer
  • 3. Which of the following shows a kinetic energy ?
    10·1 answer
  • If the 2N number is 60, then N=_______
    7·1 answer
  • What is "static pressure" in Hearing Science? <br><br> I will mark brainliest!
    11·1 answer
  • What are the raw materials for photosynthesis?
    5·2 answers
  • Match the following enzymes involved in DNA replication with their functions.
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!