Answer:
Strawberries and raspberries aren't really berries in the botanical sense. They are derived from a single flower with more than one ovary, making them an aggregate fruit. True berries are simple fruits stemming from one flower with one ovary and typically have several seeds.
Answer:
Evolution is a process that results in changes in the genetic material of a population over time. Evolution reflects the adaptations of organisms to their changing environments and can result in altered genes, novel traits, and new species.
Explanation:
Alfred Wegener suggested the Continental Drift Theory.
However, this idea was dismissed by scientists. Continental Drift Theory states
that all continents were once joined together then they drifted away from each
other. It was backed by maps which showed that if continents were pulled close
together would fit each other perfectly, just like in a puzzle. However
scientists from different fields resisted the idea and accused Wegener of not being an expert of science. The strongest reason of the
rejection, however, was that Wegener could not explain how continental drift
happened.
The phenotype would b all short hair; the genotype would be all heterozygous dominant.
hope this helps (;
Answer:
If its dna replication the answer will be TCCCCTAGTCGTGGCCTAAAGTACTCGG
If its transcription the answer will be UCCCCUAGUCGUGGCCUAAAGUACUCGG
Explanation:
