Most induced abortions occur up to 13 weeks of gestation.
Answer:
Explanation:
infectious diseases can spread in a variety of ways: through the air, from direct or indirect contact with another person, soiled objects, skin or mucous membrane, saliva, urine, blood and body secretions, through sexual contact, and through contaminated food and water.
Hope it helps
Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
