The answer is D. Identity of an element is determined by the number of protons, also called the Atomic Number. On the periodic table the atomic number is found above the element name. If you take away or add a proton, the element is not the same element anymore
Answer:
more glucose and change to a blacky-purple colour
Explanation:
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
Answer:
C. More than 5 fingers/toes on each hand/foot
Explanation:
According to the given information, polydactyly is an autosomal dominant trait which means that the phenotype would be expressed in both homozygous dominant and heterozygous dominant genotype.
The given genotype is heterozygous dominant. The individuals with heterozygous dominant genotype would exhibit the polydactyly and would have more than 5 fingers and toes on each hand and foot.
