The correct answer is tricyclic antidepressants.
Tricyclic antidepressants (TCAs) are mainly subscribed for treating depression, however they are also commonly used to treat attention-deficit hyperactivity disorder and chronic pain. Also, TCAs are used for the treatment of enuresis, also known as bedwetting.
Benzodiazepines is a type of psychoactive drugs commonly used to treat anxiety, panic disorder, generalized anxiety disorder, insomnia, seizures and alcohol withdrawal.
Selective serotonin reuptake inhibitors is a class of antidepressants used to tread depression, obsessive-compulsice disorder, generalized anxiety disorder and eating disorders.
Monoamine oxidase inhibitors are mainly used to treat depression but also panic disorder.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
The answer is C. thousands of galaxies
because<span> Hubble found 10,000 of galaxies just by observing one small little area in space.
So, it has to be thousands.</span>
B is the answer if not B then C