1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
bija089 [108]
3 years ago
12

You are given an unknown organism to identify. It is unicellular and heterotrophic. It is motile, using many short extensions of

the cytoplasm. It has well-developed organelles and two nuclei, one large and one small. This organism is most likely to be a ________.
Biology
1 answer:
Vika [28.1K]3 years ago
6 0

Answer:

The correct answer is: Ciliate.

Explanation:

  • Ciliate can be defined as single-celled eukaryotic organism belonging to the Taxonomic Phylum Protozoa.
  • They possess small but motile extensions of the cytoplasm called the Cilia. The Cilia help in their movement.
  • They possess two nucleus.
  • The larger nucleus, also called the vegetative nucleus, is polyploid in nature and helps the cell to regulate its metabolism and phenotype.
  • The smaller nucleus, also called the generative nucleus, is diploid in nature, contains the genome and is responsible for transmitting information to the next generation.
  • Other organelles in the cells are well developed.
  • An essential organelle is the Contractile Vacuole which is capable of maintaining the osmotic pressure in the cell by ejecting excess water out of the cell.
You might be interested in
Is/are used in chronic pain management, to treat attention deficit hyperactivity disorder, and as a treatment for bedwetting. be
zloy xaker [14]
The correct answer is tricyclic antidepressants.

Tricyclic antidepressants (TCAs) are mainly subscribed for treating depression, however they are also commonly used to treat attention-deficit hyperactivity disorder and chronic pain. Also, TCAs are used for the treatment of enuresis, also known as bedwetting.

Benzodiazepines is a type of psychoactive drugs commonly used to treat anxiety, panic disorder, generalized anxiety disorder, insomnia, seizures and alcohol withdrawal.

Selective serotonin reuptake inhibitors is a class of antidepressants used to tread depression, obsessive-compulsice disorder, generalized anxiety disorder and eating disorders.

Monoamine oxidase inhibitors are mainly used to treat depression but also panic disorder.
7 0
3 years ago
Read 2 more answers
3
trasher [3.6K]

Answer:

D

Explanation:

3 0
3 years ago
Read 2 more answers
PLS HELP ME WITH THIS!!!<br><br> What is the nucleotide sequence of the mRNA strand you built?
Ad libitum [116K]

Answer:

A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT

Explanation:

5 0
3 years ago
Read 2 more answers
50 POINTS!!! PLEASE HELP!!! &gt;3&lt;
tino4ka555 [31]
The answer is C. thousands of galaxies

because<span> Hubble found 10,000 of galaxies just by observing one small little area in space.

So, it has to be thousands.</span>
7 0
3 years ago
Read 2 more answers
What is the definition of a hydrocarbon?(1 point)
user100 [1]
B is the answer if not B then C
7 0
3 years ago
Read 2 more answers
Other questions:
  • Compare the basic treatments for type 1 and type 2 diabetes
    9·2 answers
  • Saprophytes are fungi that feed on dead and decomposing organisms. They secrete enzymes that digest components of cell walls, su
    12·2 answers
  • Which of the following is a character of a low pressure system
    6·2 answers
  • 8. What structures get duplicated during interphase I?
    7·1 answer
  • Al of the following are light colored fish except a. swordfish b. catfish c. sole d. shrimp
    6·1 answer
  • Which of the following is an example of the endocrine system directly interacting with the nervous system?
    14·1 answer
  • Fossils can be formed in the mud because
    5·2 answers
  • Why is it important to regulate salt in cells?
    6·1 answer
  • Why would another parasitic organism, such as a disease-causing bacteria, be
    8·1 answer
  • Are landslides considered a form of weathering, erosion, or deposition? Explain your answer.
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!