1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
hoa [83]
3 years ago
7

In living cells, what is the energy carrier that fuels most kinds of cellular work? glucose ATP ADP

Biology
1 answer:
zvonat [6]3 years ago
6 0
Your answer will be ATP
You might be interested in
7. Gamete cell occurs in ?<br> Your answer:<br> Mitosis<br> Meiosis<br> Cytokinesis
Furkat [3]

Answer:

Meiosis

Explanation:

8 0
2 years ago
Read 2 more answers
\85. compare the equation for cellular respiration to the equation for photosynthesis.
Alexandra [31]

Answer: The reactants for Photosynthesis are the products for Cellular Respiration and the reactants of Cellular Respiration are the products of Photosynthesis.

Photosynthesis:

6CO2 + 6H2O -> C6H12O6 + 6O2

**6 Carbon Dioxide + 6 water -> Glucose + 6 Oxygen**

Cellular Respiration:

C6H12O6 + 6O2 -> 6H2O + 6CO2 + Energy

**Glucose + 6 Oxygen -> 6 Water + 6 Carbon Dioxide + Energy**


8 0
3 years ago
Whats the correct answer answer asap for brainlist
Damm [24]
4
Because there are 4
6 0
1 year ago
_____ is a force caused by air that slows objects down
mr_godi [17]

Answer:

Friction

Explanation:

7 0
3 years ago
Read 2 more answers
2. Dominant trait: cleft chin (C) Mother’s gametes: Cc
kakasveta [241]

Answer No 2:

      c      c

C   Cc     Cc

c    cc      cc

The genotype of the offsprings would be Cc, Cc, cc, cc i.e heterozygous cleft chin and no cleft chin. The phenotype of the offsprings could be 50% cleft chin and 50% without cleft chin.

there will be 50% chance of the child to have cleft chin.

Answer No 3:

        A        a

A     Aa       Aa

a      Aa        aa

There will be 25% chance for the offspring to have arched feet. As arched feet is a recessive trait, so for this trait to occur both the alleles of the gene should be recessive i.e aa.

Answer No 4:

    B      b

b   Bb    bb

b    Bb    bb

As blonde is a recessive trait, so both the alleles for this gene should be recessive for this trait to occur. Hence, according to the punnet square, there will be 50% chance for the offspring to be blonde.

Answer No 5:

           F      f

F          FF    Ff

f           Ff     ff

As normal vision is a resessive trait, hence both the alleles of the gene should be recessive for the trait to occur. According to the punnet square, there is 25% chance that the child will have normal vision.

3 0
3 years ago
Other questions:
  • Features that are homologous are similar due to __________.
    12·1 answer
  • Circle or highlight the six most common elements found in living things. do the same thing for the five other elements that are
    8·2 answers
  • Why is the term linchpin appropriate in describing the termites
    10·1 answer
  • The enzyme responsible for converting androgens to estrogens is select one:
    9·1 answer
  • This is also do June 4
    9·2 answers
  • A(n)<br> is a group of organisms that can mate and produce offspring that can mate.
    11·1 answer
  • WILL GIVE BRAINIEST IF THEY GIVE A CORRECT ANSWER!!! 50 POINTS!!!!<br> what eats sunbeam snakes?
    9·2 answers
  • I need help please I wanna pass this class
    11·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Normal human cells have ________ chromosomes while gametes have ________ chromosomes.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!