1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
omeli [17]
3 years ago
7

The two nucleotide chains of RNA twist into a double helix shape. true or false ​

Biology
2 answers:
pantera1 [17]3 years ago
8 0

Answer:

True

Explanation:

The ladder is twisted into a spiral shape called a double helix.

Sav [38]3 years ago
6 0

Answer:

False

Explanation:

In DNA, there are four possible nitrogen bases – adenine (A), guanine (G), cytosine (C), and thymine (T). In DNA, nucleotides combine to form two long chains that intertwine with each other, like a ladder that has twisted into a spiral.

You might be interested in
What stores and delivers nutrients throughout the cell and transports waste to the cell membrane
mixer [17]

\huge \sf \star{Answer} \star

Vacuoles store water, food, and waste. The endoplasmic reticulum (ER) is a series of tunnels throughout the cytoplasm. They transport proteins from one part of the cell to another. Ribosomes are the protein factories of the cell.

<h3>Hope it helps uh...</h3>

6 0
3 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
2 years ago
the slash and burn system of deforestation reduces the number of oxygen producing and puts more carbon in the air
LekaFEV [45]
I think you wanted to know whether the statement in question is true or false. Based on this assumption, i am answering this question and hope that it helps you. It is absolutely true that the slash and burn system of deforestation reduces the number of oxygen producing and puts more carbon in the air.
8 0
3 years ago
Read 2 more answers
Someone help me pleaseeee
allochka39001 [22]
It’s c Xand Y good luck sweetie
6 0
3 years ago
3.  Through which process will metamorphic rock and igneous rock change into sedimentary rock? (1 point) cooling of lava weather
larisa [96]
Your answer is B weathering, deposition, and erosion :D i really hope i helped you!
7 0
3 years ago
Read 2 more answers
Other questions:
  • Miriam lives in New Zealand. She watches the stars nightly. Every evening, all year long, she can see the constellation Crux (th
    7·1 answer
  • In the ______________ process of DNA replication, each of the single strands becomes a double strand as an enzyme connects the a
    6·1 answer
  • When you anticipate the results of your expierement before you begin, you are making a
    7·1 answer
  • If all the genes of e. coli were active at once what would happen
    14·2 answers
  • Which Organelle is only found in plant cells?
    5·2 answers
  • Explain why muscle can be described as a tissue
    15·1 answer
  • The viruses are organisms
    7·1 answer
  • What are groups of organisms of the same species that interact?
    8·1 answer
  • A snake species that has migrated from the mainland to a small island eats banana slugs instead of lizards and mice, its usual d
    12·1 answer
  • Large ears Survival Advantage
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!