1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
2 years ago
10

30 PTS Answer correctly please What is the difference between DNA and RNA?

Biology
2 answers:
SVEN [57.7K]2 years ago
4 0

DNA is a double stranded molecule

RNA is a single stranded molecule

DNA is responsible for storing and transferring genetic information. RNA directly codes for amino acids and as acts as a messenger between DNA and ribosomes to make proteins.

DNA uses the bases adenine, thymine, cytosine, and guanine A-T C-G

RNA uses adenine, uracil, cytosine, and guanine.  A-U C-G

Alika [10]2 years ago
3 0
Structurally, DNA and RNA are nearly identical. As mentioned earlier, however, there are three fundamental differences that account for the very different functions of the two molecules. RNA has a ribose sugar instead of a deoxyribose sugar like DNA. RNA nucleotides have a uracil base instead of thymine.
You might be interested in
A shot putter pushes on a 4 kg shot with a force of 500 N forward and a force of 866 N upward. How large is the resultant force
Zinaida [17]

It would be 1000N

Could I have Brainliest?

6 0
3 years ago
What is the largest organ in your immune system? *
bonufazy [111]
Lymphoid organs in the immune system, includes the bone marrow
5 0
2 years ago
Energy enters a food chain as heat energy and leaves it as light energy.
hjlf

Answer:

The statement that says "Energy enters a food chain as heat energy and leaves it as light energy" is false.

Explanation:

The energy that enters the food chains, first of all, is light energy from the sun. This energy is assimilated by plants to convert it into chemical energy, through  photosynthesis.

When energy flows from producers, plants, to consumers and decomposers, a great amount of <u>energy is lost, in the form of </u><u>heat energy</u>, due to the metabolism of living beings. Additionally, the second law of thermodynamics states that when energy passes from one form to another it leads to disorder in the system, which would also explain the loss of energy.

The true statement is "Energy enters a food chain as <u>light energy</u> and leaves it as <u>heath energy"</u>.

8 0
2 years ago
Explain why some peas in the experiment produced carbon dioxide
Stells [14]
The peas haven't start germinating, which means no leaves. They can't undergo photosynthesis to produce oxygen. At this stage they are still undergoing respiration, which produce carbon dioxide.
5 0
3 years ago
What is not a function of the endomembrane system of the cell?
mina [271]
<span>In your cell, this is where the endomembrane system comes in a cell image because one is studded with small ribosomes and one is not.it does not help the cell move.IT IS not a function of the endomembrane system of the cell</span>
5 0
3 years ago
Other questions:
  • How do you clap cheek that a flat??
    15·2 answers
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Which of the following is true of carbon dioxide exchange? Select one: a. Carbon dioxide is produced in the mitochondria and cyt
    13·1 answer
  • Overall, this __________ based on the changes in free energy that take place as a is converted to
    13·1 answer
  • !!!!!!PLEASE HELP!!!!!!
    13·2 answers
  • Which is the result of using one or more of your senses to gather information
    15·2 answers
  • A cell has a defect that results in the loss of its ability to selectively regulate the passage of certain molecules into and ou
    5·1 answer
  • How do Pesticides Affect Biodiversity?
    7·1 answer
  • _________10. Which of the following groups of plants carry out light dependent and light independent reactions of
    10·1 answer
  • Draw a line from each hormone in list A to the correct information in list B
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!