1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Semenov [28]
3 years ago
10

30 PTS Answer correctly please What is the difference between DNA and RNA?

Biology
2 answers:
SVEN [57.7K]3 years ago
4 0

DNA is a double stranded molecule

RNA is a single stranded molecule

DNA is responsible for storing and transferring genetic information. RNA directly codes for amino acids and as acts as a messenger between DNA and ribosomes to make proteins.

DNA uses the bases adenine, thymine, cytosine, and guanine A-T C-G

RNA uses adenine, uracil, cytosine, and guanine.  A-U C-G

Alika [10]3 years ago
3 0
Structurally, DNA and RNA are nearly identical. As mentioned earlier, however, there are three fundamental differences that account for the very different functions of the two molecules. RNA has a ribose sugar instead of a deoxyribose sugar like DNA. RNA nucleotides have a uracil base instead of thymine.
You might be interested in
Where is DNA stored in the cell?
zzz [600]

Answer:

in the cell nucleus

Explanation:

Most DNA is located in the cell nucleus where it is called a nuclear DNA.

7 0
3 years ago
 20 points !! asap pls                     In an ecosystem, organisms are dependent on each other for their survival. Small fish
just olya [345]
3. Mechanical energy is the energy used by organisms to function and move.

3. The conservation of energy is the process in which organisms use up the energy in a cycle where nothing is wasted.


Hope it helped,

Happy homework/ study/ exam!
7 0
3 years ago
Read 2 more answers
Why are DNA fingerprints are more reliable than hand fingerprints in solving crimes.
UNO [17]
Dna gives an automatic trace, ur dna is original and no one else has it so it’s easier to track
5 0
3 years ago
What gas was non existent 2.5 billion years ago
gogolik [260]
Fossil fuel was non existent 2.5 billion years ago
7 0
3 years ago
After germination, continued plant growth pushes first the shoot and then leaves through the soil. We would expect the emergent
olga55 [171]
What do you think it would be? 

7 0
3 years ago
Read 2 more answers
Other questions:
  • What would decrease peripheral resistance to blood flow?
    11·1 answer
  • Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
    8·1 answer
  • Adrenalin (epinephrine) is the "fight-or-flight hormone". One of its physiological roles is to mobilize fuel stores in preparati
    13·1 answer
  • Describe the<br>Inter relation<br>bla<br>living and living thing in a tabular form​
    15·1 answer
  • Why are bacteria needed in the nitrogen cycle?
    10·1 answer
  • Why are there three different wind patterns in each hemisphere
    8·1 answer
  • What is the volume of the golf ball? Cm3
    11·2 answers
  • OK last couple didnt work so heres a real one! will mark brainliest..... what makes up a atom?
    13·2 answers
  • An image produced by a microscope is called
    5·1 answer
  • Human decisions about controlling erosion have very little effect on living conditions.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!