1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Oksi-84 [34.3K]
3 years ago
12

two organisms are in the same phylum but not in the same class. Another pair of organisms are in the same genus. Which pair has

more in common?
Biology
1 answer:
Zigmanuir [339]3 years ago
8 0
Another pair of organisms are in the same genus
You might be interested in
Domestic houses have 64 chromosome in a normal body cell.How many chromosomes should be in an egg cell of a female horse?
enot [183]
The answer is 32 because any offspring receives an equal amount of chromosomes from the mother and the father.
8 0
3 years ago
Which tools do meteorologists use to help create weather forecasts? Check all that apply. guesses computer models weather servic
kap26 [50]

Answer: weather service maps, data from instruments and personal observations

A meteorologist is a scientific professional who applies scientific principles to explain, observe, understand and forecast the changes that can occur in an earth's atmosphere they also find out how the changes in the earth's atmosphere affects the climate and the life of the organisms. They can predict the changes in the atmosphere by weather service maps, data from the instruments and from the personal observations.

8 0
4 years ago
Read 2 more answers
In what ways are herbivores and carnivores alike
klemol [59]
Carnivors eat meat like lions and herbivores eat plants like deer

7 0
4 years ago
When was the Japanese sea lion discovered
Bezzdna [24]

Answer:1900s

Explanation:

5 0
4 years ago
Read 2 more answers
Select the correct answer.<br> What is the purpose of creating an outline for a research paper?
fiasKO [112]

Answer:

Creating an outline helps an author to better organize their ideas for a paper before writing the rough draft.

Explanation:

8 0
2 years ago
Other questions:
  • 2. Which of the following can survive either with oxygen or without it?
    6·2 answers
  • Which of the following statements about wildfires in deciduous forests is not true?
    11·2 answers
  • A DNA sequence encoding a five-amino acid polypeptide is given below. …ACGGCAAGATCCCACCCTAATCAGACCGTACCATTCACCTCCT…
    14·1 answer
  • So which one is it A,B or C?
    10·1 answer
  • what is one action that humans would take to protect human and ecosystem health from the effects of west mile virus
    5·1 answer
  • Chloe’s mother wants to have another child. However, she is concerned that a second child might also have CF, so she encourages
    11·1 answer
  • Which genetic or chromosomal abnormality below is correctly matched with its description?
    15·1 answer
  • This image represents:
    12·1 answer
  • Which phase of cell division is shown?<br> prophase<br> Anaphase <br> Metaphase <br> telophase
    5·2 answers
  • What is the since of naming and grouping organisms called??
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!