1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
oksano4ka [1.4K]
3 years ago
9

One way in which complement activation destroys pathogens is by C3a binding to ____________ , which then causes inflammation thr

ough histamine and heparin release.
Biology
1 answer:
wel3 years ago
4 0

Answer:

One way in which complement activation destroys pathogens is by C3b binding to the surface of microbes, which then causes inflammation through histamine and heparin release.

Explanation:

C3b binds to the surface of microbes (opsonin), and functions as a component of C3 and C5 convertases while C3a stimulates inflammation.

The alternative pathway of complement activation is triggered by the deposition of C3b on the surface of a microbe. The microbe- bound C3b binds another protein called Factor B, which is then broken down by a plasma protease called Factor D to generate the Bb fragment.

This fragment remains attached to C3b, and the C3bBb complex functions as an enzyme, called C3 convertase, to break down more C3. The C3 convertase is stabilized by properdin, a positive regulator of the complement system.

As a result of this enzymatic activity, many more C3b and C3bBb molecules are produced and become attached to the microbe. Some of the C3bBb molecules bind an additional C3b molecule, and the resulting C3bBb3b complexes function as C5 convertases, to break down the complement protein C5 and initiate the late steps of complement activation.

The main effectors of the complement system are opsonization, cell lysis and inflammation. It also stimulates B cell responses and antibody production.

You might be interested in
______ is a defense mechanism that occurs when group members believe the logical, but false explanation of their behavior.
Ede4ka [16]

Answer:

The correct answer is- Rationalization

Explanation:

Rationalization is a defense mechanism that involves the action to justify their unobvious behaviors by logical reasons to avoid true explanation. For example, if an employee is not given promotion might rationalize his disappointment by saying that he does not want extra responsibilities.

Rationalization may help the person to avoid guilt and maintain self-respect when he has done something wrong. Many times rationalization is not harmful to the person but if it becomes a habit of a person it can cause a problem for him and others. Therefore the correct answer is rationalization.

3 0
3 years ago
Which term refers to a universal fact sometimes based on mathematical equations?
seraphim [82]
Scientific law. For example, Law of Universal Gravitation.
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
How many bones are in the human body?
liraira [26]

Answer:

206 bones

Explanation:

4 0
3 years ago
Read 2 more answers
Which best describes how to classify water?
Anastaziya [24]

Answer:

b)It is a compound because it is made of a single kind of molecule.

Explanation:

8 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following reactions is used to radioactively label DNA?
    7·2 answers
  • There are 14 boys and 7 girls in science class. simplify the ratio
    12·1 answer
  • _____ arise from a single fertilized egg and are thus genetically almost identical.
    12·2 answers
  • What period did ice-age mammals first appear?
    8·1 answer
  • The t locus is involved in the production of tails in a mouse; tt individuals are without tails, whereas TT and Tt have tails. T
    9·1 answer
  • An otter breeder discovers several pups with pointy ears. She attempts to establish a bunch of pointy eared-otters by selling of
    15·1 answer
  • Plssss help
    10·1 answer
  • Mitosis makes.....<br> A. cell phones<br><br> B. identical body cells<br><br> C. sperm and egg cells
    7·2 answers
  • When a object remain in the same place is called
    10·2 answers
  • Describe the process that maintained a stable tasmanian devil population size before the appearance of dftd in 1996.
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!