AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
A frameshift mutation<span> (also called a framing error or a reading </span>frame shift<span>) is a genetic </span>mutation caused<span>by indels (insertions or deletions) of a number of nucleotides in a DNA sequence that is not divisible by three.</span>
A. Cell membrane would be the answer.
Answer:Option A
Explanation: The snail breaths in the O2 which will then exhale CO2, therefore the plant will take that and process the CO2 back into O2.
