1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leokris [45]
3 years ago
6

Air moves into the lungs when the air pressure in the lungs is than the air pressure outside of the lungs this occurs when the m

uslces of the diaphragm
Biology
1 answer:
storchak [24]3 years ago
3 0
Air moves into the lungs when the air pressure in the lungs is lower than the air pressure outside of the lungs. This occurs when the muscels of the diaphragm contract.

You can see this by breathing in and out deeply. When you breath in you can feel your chest being pushed up and out by your diaphragm. The reason the pressure in the chest is lower is that when you breathe in you are increasing the volume of your chest. As there is the same amount of air in your chest the pressure decreases.
You might be interested in
Select all answers
Vesnalui [34]
A,B,C,D I'm pretty sure, but check with others who answer the question too.
6 0
2 years ago
Read 2 more answers
The ___ culture was the first to keep accurate health records.
aniked [119]
The Egyptian culture.
8 0
3 years ago
Read 2 more answers
Which of the following rock types would be more likely to have a course grained texture
Brilliant_brown [7]

Answer:

granite

Explanation:or basalt

please thanks this answer by pressing the heart

8 0
3 years ago
Animals cannot synthesize tyrosine from shikimate-3P because they lack EPSP synthase. However, tyrosine is listed as a non-essen
Marina86 [1]

Tyrosine is listed as a non-essential amino acid because it can be synthesised from the essential amino acid phenylalanine.

<u>Explanation:</u>

Amino acids are classified as essential and non essential according to whether they can be synthesized in the body itself or should be supplied by the diet. Essential amino acids cannot be synthesized in the body of the organism and thus can be obtained only from the diet. In the case of human beings, valine, phenylalanine, methionine etc are examples of essential amino acids.

Non essential amino acids can be synthesized within the body of the organism. Thus they need not be supplied by the diet. Alanine, aspartic acid etc are some of the non essential amino acids in human beings. It is given here that animals cannot synthesize tyrosine from shikimate-3p due to the lack of EPSP synthase.

But the amino acid tyrosine can be synthesized from the amino acid phenylalanine which is an essential amino acid. Thus tyrosine will be a non-essential amino acid.

8 0
2 years ago
PLEASE HELP ILL GIVE BRANLEST AND 15 POINTS PLEASE SOMEONE
vodka [1.7K]

Answer:

1. Air warms, becomes less dense, it rises

2. Air cools down, increases density (becomes denser), it sinks

4 0
2 years ago
Other questions:
  • An individual whose genotype is AABbCc is crossed with an individual who is heterozygous for all three of these genes. If this c
    12·1 answer
  • In a species of wild animal, claw size is determined by a combination of two alleles. Allele Q codes for large claws, while alle
    12·1 answer
  • Which is the most common method of tree harvesting for an even aged forest stand?
    13·1 answer
  • Which best compares DNA and RNA with regard to the process of protein production?
    8·2 answers
  • Which is an example of a stimulus and the accompanying response of an organism?
    11·1 answer
  • Fiona has a lovely flower bed in her yard. She wants to add a fence along one side of the flower bed. The fence material is sold
    6·2 answers
  • Which of the following are types of homogeneous mixtures? (Select all that apply)
    10·1 answer
  • Prior Knowledge Questions (Do these BEFORE using the G
    13·1 answer
  • A national park is home to large populations of mountain lions, deer, rabbits, and grass. Recently, park rangers decided to intr
    14·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!