These alveoli are the smallest types of lung tissue, and one of the most important. In addition to being the primary means by which oxygen enters and carbon dioxide escapes the bloodstream, these small pouches of air are also the reason why the lungs do not totally collapse when a person breathes out. This is because they contain a cell that secretes a special chemical to lower the surface temperature to prevent lung collapse. The alveoli also contain other cells that secrete chemicals to attack and remove any foreign objects in the lungs, such as dust, dirt and other debris.
In addition to making up alveolar sacs, alveoli also form alveolar ducts. It is estimated that there are more than 300 million alveoli in the human lungs, all of which are located in either alveolar ducts or sacs that are found at the end of the smaller passageways, or bronchioles, in the lungs.
SHORT ANSWER:
Alveolar sacs contain tiny pouches called alveoli, whose primary function is gas diffusion. These clusters of alveoli have thin walls that allow oxygen to pass easily from the lungs into the bloodstream and carbon dioxide to flow from the blood to the lungs so it can exit the body.
Answer:
C. Light intensity
Explanation:
they need light to grow so they stay near the ocean surface because that's where the most light is
From the data, the manatee population obviously increased after the regulations went into affect and the deaths due to watercraft reduced from 25 to 8 after the regulations were put into effect. The population increased by 165% from 1980=-2010 and the drop in deaths due to watercraft decreased by
68%.So this is not a direct correlation but at least it shows that the watercraft deaths decreased significantly. Since the population increased at a greater rate then it may be that more females were spared so could mate and give birth to that many more manatees.
She was suggested to increase calcium phosphate and reduce soda content because acidic soda dissolves the calcium phosphate of the teeth.
Explanation:
Calcium phosphate is an important mineral which keeps the teeth firm and strong. If calcium phosphate is not present in adequate quantity it will cause the teeth to become soft and easy for cavities to get formed.
Calcium phosphate naturally repairs the teeth by remineralization process.
Soda contains phosphoric and citric acids which dissolve the protective layer of calcium phosphate of the teeth and makes it brittle causing increased cavities.
Answer:
AUGUUAGUUCGUGAACGUUCUGAUUAA if its rna transcription and replace the U's with T's if its dna replication
Explanation:
