1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zielflug [23.3K]
3 years ago
8

Question 9 of 17

Biology
1 answer:
Zolol [24]3 years ago
6 0
False.

During cellular respiration, a glucose molecule is gradually broken down into carbon dioxide and water.
You might be interested in
A single strand of DNA contains the following nine nucleotides in this order: ACT TAT GGA. What sequence of bases will be presen
Orlov [11]
The complementary DNA strand is as follows:
TGA   ATA   CCT 
7 0
3 years ago
Read 2 more answers
If a molecule of DNA has 200 pairs how do the DNA molecules fit into the cell?
Lapatulllka [165]

I do not know but does it depend on how big or what the temperature is

3 0
2 years ago
Read 2 more answers
Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
Kryger [21]

agcgggaugagcgcauguggcgcauaacug
4 0
3 years ago
Which organelle produces food through photosynthesis?
RSB [31]

Answer:

choloroplast

Explanation:

chloroplasts contain chloropyll, the green pigment that absorbs sun energy, therefore its the organelle responsible for photosynthesis

5 0
2 years ago
Is a plasma membrane composed of carbohydrates, lipids or both
Flauer [41]

just carbohydrates my guy

7 0
3 years ago
Read 2 more answers
Other questions:
  • Current scientific methods can conclusively distinguish between all microorganisms
    6·1 answer
  • The limbic system is responsible for ____________. connecting the brain to the rest of the body fighting disease organisms that
    7·1 answer
  • Which cells in the liver perform this function of removing bacteria and foreign material from the portal blood?
    11·1 answer
  • Whats mercury's scaled diameter
    10·1 answer
  • Show how artificial selection could be used to develop a new breed of wheat with higher fiber content
    8·1 answer
  • PLEASE SOMEONE HELP ME PLEASE!!!
    10·1 answer
  • The process by which sediments are laid down or deposited.
    14·2 answers
  • Help Please...Needed Quickly
    12·2 answers
  • An immunocompromised host is one who shows a decrease in ______.
    15·1 answer
  • Food must be broken down into________
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!