1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
castortr0y [4]
3 years ago
11

Two genetic diseases, Hunter and Hurler syndromes, are caused by an inability of cells to break down and recycle mucopolysacchar

ides, which are substances found in the extracellular areas of the body. Which organelle is responsible for performing this function in normal cells?
Biology
2 answers:
IgorC [24]3 years ago
5 0

Answer:

Its is a lysosomal storage disease!

Explanation:

<u>Hurler syndrome:-</u> is also known as mucopolysaccharidosis-I .

It Is due to the mutation on chromosome 4 .

There is a lack of of enzyme called alpha-L-iduronidase.This enzyme is present in lysosomes

It causes accumulation of mucopolysaccharides because of the absent of the enzyme in the lysosome

<u>Hunter syndrome:- </u>is also known as mucopolysaccharidosis-II

It occurs due to mutation in iduronate-2-sulfatase (IDS) gene.It is an X-linked disease

melisa1 [442]3 years ago
3 0

Two genetic diseases, Hunter and Hurler syndromes, are caused by an inability of cells to break down and recycle mucopolysaccharides, which are substances found in the extracellular areas of the body. A lysosomes is an organelle responsible for performing breaking down and recycling function in normal cells.

<u>Explanation: </u>

The lysosomes is one of the important organelles in the intra-cellular digestive systems. Its main function involves removal of wastes, including digestion of excess worn-out cells, viruses, bacteria, and other food particles.

It contains acid hydro-lase which is a digestive enzyme. Due to these functions, it is also otherwise called scavenger of the cells. Malfunctioning of lysosomes will result in LSD, lysosomes storage disorders.

Examples: Hunter syndrome, Fabry and Gaucher disease.

You might be interested in
What are three general ways in which cells use energy?
Vanyuwa [196]
Chemical, digestion mechanical, thinking
3 0
3 years ago
Chemical signals that influence neuronal functionality in widespread areas rather than at isolated synapses are called ___.
egoroff_w [7]
Chemical signals that influence neuronal functionality in widespread areas rather than at isolated synapses are called <span>neuromodulators</span>
5 0
3 years ago
Who invented bifocal eyeglasses and a clean-burning stove, and helped develop the U.S. postal system?
viva [34]

Answer:

Benjamin Franklin

Explanation:

Benjamin Franklin was one of the founding fathers of America and he is well known for his many inventions as well. All the mentioned inventions were invented by him along with his contribution towards development of U.S Postal system.

4 0
3 years ago
3/13<br> When do scientific ideas change?
Evgen [1.6K]

Answer:

When man kind started to seek more knowledge on behavior and structure of world.

Explanation:

Scientific idea is an explanation for how something works, or the truth about some aspect of the world, that was figured out using the scientific process.

4 0
4 years ago
The solutions in the two arms of a U-tube are separated by a membrane that is permeable to water and glucose but not to sucrose.
soldi70 [24.7K]

Answer:

hypertonic

Explanation:

The solution in side A is<u> hypertonic</u> with respect to side B.

<em>A hypertonic solution is a solution with a higher concentration of solutes in comparison with a neighbouring solution separated by a selectively permeable membrane.</em>

I<u>n terms of both sucrose and glucose concentrations, the solution in side A is higher than the solution in side B of the U-tube. Hence, side A is hypertonic to side B.</u>

A hypertonic solution is as opposed to a hypotonic solution with the latter having a lower concentration of solutes as compared to a neighbouring solution. Isotonic solutions have equal solute concentrations with their neighbouring solutions.

3 0
3 years ago
Other questions:
  • Up Name 1. A large pool of trash, known to be the size of 3 Texas, floats around in the middle of the Pacific Ocean. Pollution f
    7·2 answers
  • How does human activity affect the availability of food for deer population and what does this have on the deer population?
    15·1 answer
  • Mr. Casa wants to put a fence around a circular
    9·1 answer
  • What important role does fire play in a temperate grassland biome?
    6·1 answer
  • ANSWER ASAP!!!!!!
    9·2 answers
  • C6H12O6 + O2 → 6 CO2 + 6 H2O
    8·1 answer
  • What is the advantage for birds of not having a bladder?
    14·1 answer
  • Depletion of nonrenewable resources is often a result of?
    6·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • If the researcher compares mRNA from inside the nucleus to mRNA from the ribosomes, what will be found
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!