1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
raketka [301]
3 years ago
6

Solution A contains 5 grams of sugar per liter while solution B contains 2 grams of sugar per liter. The solutions are separated

by a selectively permeable membrane. If the solvent in both solutions is water, predict in which direction most of the water molecules will move.
A. move by simple diffusion from solution A to solution B
B. move by osmosis from solution B to solution A
C. move by active transport from solution B to solution A
D. move by filtration from solution A to solution B
E. There will be no movement of water.
Biology
2 answers:
Nady [450]3 years ago
5 0

Answer:

B. move by osmosis from solution B to solution A

Explanation:

Remember that osmosis as a process by which molecules of a solvent tend to pass through a semipermeable membrane from a less concentrated solution into a more concentrated one.

Alekssandra [29.7K]3 years ago
5 0

Answer: B. move by osmosis from solution B to solution A

Explanation: SEMI PERMEABLE MEMBRANE Is a membrane that selectively permeats materials to pass through it,it selects materials and substances according their particle size,shape concentration etc.

Osmosis is the movement of water or other solvent molecules from a region of lower concentration to another region of higher concentration through a semi permeable membrane.

You might be interested in
If an epidemic were declared in our town what could happen to control and eventually eliminate it
BlackZzzverrR [31]
The etiologic agent of the disease must be first identified. The most important thing to know is the source of the organism. Transmission of the disease must be identify to prevent further spread and limit the number of persons with the disease.The route,mode of transmission should be identified. Quarantine of those infected and symptomatic can be done if necessary. The initiation of treatment must be started once infection is identified. Prophylaxis can also given to those individual at risk of acquiring the disease.
8 0
3 years ago
A patient will be taking amiodarone [cordarone]. which baseline tests are necessary before this medication is started? (select a
olga55 [171]
Upon researching, I believe the choices are:

<span>A. Chest radiograph and pulmonary function tests
B. Complete blood count with differential
C. Ophthalmologic examination
D. Renal function tests
E. Thyroid function tests
</span>
Among these, the baseline tests necessary for the patient before taking the medication are: A. Chest radiograph and pulmonary function tests, C. Ophthalmologic examination, and E. Thyroid function tests. This is because Amiodarone has several possible toxic side effects. Some of these are thyroid toxicity, opthalmic effects, and pulmonary toxicity. Thus, it is necessary to first know the baseline of the patient for these systems and then checking if the results have deviated much after he/she takes the medication.  
5 0
3 years ago
Read 2 more answers
In his study of pea plants, Gregor Mendel used which method to produce offspring?
likoan [24]
Cross-Pollination was used
3 0
3 years ago
Read 2 more answers
What are some diseases that can be passed down as genetic traits? list 5 or more/
Oxana [17]
The diseases which can be passes down as genetic traits are known as "Inheritable disease" some examples are:

1) Haemophilia
2) Phenylketonuria
3) Down's Syndrome
4) Turner's Syndrome
5) Klinefelter's Syndrome

Hope this helps!
6 0
3 years ago
Read 2 more answers
Is there any type of ecological relationship between wolf and moose populations on Isle Royale? If not, explain why not. If so,
Cerrena [4.2K]

The Prey-Predator relationship is the type of ecological relationship between wolf and moose populations on Isle Royale.

<h3>What do you mean by Ecological relationship?</h3>

The Ecological relationship may be defined as the interaction between the members of one species with respect to the members of the other in response to food, shelter, and space.  

Moose are herbivores and the prey of wolfs. It is clearly seen in the graph that when the population of wolves increases, the number of moose decreases. It states that wolfs feed on moose.

Therefore, the Prey-Predator relationship is the type of ecological relationship between wolf and moose populations on Isle Royale.

To learn more about Ecological relationships, refer to the link:

brainly.com/question/2240608

#SPJ2

4 0
2 years ago
Read 2 more answers
Other questions:
  • If a nerve cell receives many ipsps in different locations at the same time, ____
    5·1 answer
  • The formation of a zygote and a cell with a triploid nucleus is unique to flowering plants. what is this process called?
    15·1 answer
  • How could an error during transcrition affect the protein that is produced
    10·1 answer
  • How is energy expended in active transport​
    12·1 answer
  • The diagram shows a coil of copper wire wrapped around an iron cylinder and connected to a battery.
    7·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Identify the similarities and differences between the different types of microscopes
    7·1 answer
  • What is the sequence (from left to right) of the complementary<br> DNA strand?
    14·1 answer
  • Which of the following is a true statement?
    13·2 answers
  • What's the role of GALT to the digestive system
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!