1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ExtremeBDS [4]
3 years ago
12

What is the main function of albumin?

Biology
1 answer:
docker41 [41]3 years ago
7 0
The answer is in the file I attached.

You might be interested in
Is cytokinesis a part of mitosis ?
stich3 [128]
Cytokinesis is part of M-phase, but not part of Mitosis. M-phase consists of nuclear division (mitosis) and cytoplasmic division (cytokinesis). And yes, telophase is part of mitosis, so it's in M-phase <span>too.

I hope my answer has come to your help. Thank you for posting your question here in Brainly. We hope to answer more of your questions and inquiries soon. Have a nice day ahead!
</span>
5 0
3 years ago
The nurse considers that a 70-year-old female client can best limit further progression of osteoporosis by doing what?
Alenkinab [10]
The nurse considers that a 70-year-old female client can best limit further progression of osteoporosis by taking supplement which contains vitamin D and calcium. Osteoporosis is a bone condition where one develops a fragile bone that is very susceptible to fracture. Causes for this condition can be genetics, lack of physical activity, insufficient amount vitamin D and calcium in the body, smoking and many other. This condition does not have any symptoms with it until fractures in the bones happen. One way to prevent or decrease the chances of developing it to serious cases is to supply your body the right nutrients and vitamins.
7 0
4 years ago
What does it mean when i say that butterflies represent me
tensa zangetsu [6.8K]

Answer: it could mean you are nervous people often refer butterflies to a nervous jittery feeling in their stomach or it could mean your pretty or when people call other people names and things like that then you could say im just a catterpillar now but im gonna transform into a beautiful butterfly soon id.k im not really sure

4 0
3 years ago
Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
coldgirl [10]

Answer:

Your understandable!

Explanation:

The words you've used are unreadable!

4 0
3 years ago
Sensory receptors convert _____ into _____ by signal transduction.
strojnjashka [21]

Sensory receptors convert stimulus into electrical signals by signal transduction.

<h3>What is sensory receptors?.</h3>

Sensory receptors are found in specialized organs such as the eyes, ears, nose, and mouth, as well as internal organs. Each receptor type transmit stimulus or sensory modality which is interpreted to electrical signal and into a single perceptual frame eventually.

Therefore, Sensory receptors convert stimulus into electrical signals by signal transduction.

Learn more about sensory receptors here.

brainly.com/question/9173579

4 0
3 years ago
Other questions:
  • John is a smoker. he has at least doubled risk of which mental disorder?
    11·1 answer
  • How does water move across a cell membrane?
    11·1 answer
  • Which is not a function of nutrients?
    8·2 answers
  • State the difference between prokaryotic and eukaryotic cells
    13·1 answer
  • These groups of reproducing populations that are isolated from other groups
    7·2 answers
  • Pls help me on the HT
    12·1 answer
  • In simple dominance what is the result when a dominant allele pairs up with a recessive allele
    14·1 answer
  • Use the following dichotomous key to identify an irregular blue flower with five petals and a fruit that is a ripened flower ova
    6·1 answer
  • Define what is ABIOTIC COMPONENT *
    8·2 answers
  • The width of the labelled cell in Figure 4 is 6 mm. The cell has been magnified 750 times.
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!