1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
umka2103 [35]
3 years ago
8

⚠️⚠️⚠️ i will mark brainliest identify one level above and below alveoli, and list the levels of organisation in humans

Biology
1 answer:
geniusboy [140]3 years ago
5 0

Explanation:

A cell is the smallest independently functioning unit of a living organism. Even bacteria, which are extremely small, independently-living organisms, have a cellular structure. Each bacterium is a single cell. All living structures of human anatomy contain cells, and almost all functions of human.

You might be interested in
Which is a characteristic of unsaturated fats? they easily stack on top of each other. they come from plant steroids. they make
ira [324]
They are liquids at room temperature
4 0
4 years ago
Read 2 more answers
For larger distances such as the distance between objects in the far reaches of our galaxy astronomers ensure in units of?
Scorpion4ik [409]

Answer:

Lightyears

Explanation:

When dealing with very large interstellar distances, astronomers do not use the regular miles, kilometers, or meters we are used to. This is because they are just too small to be used as a metric when measuring such large distances. As a matter of fact, the earthly number system will quickly be exhausted when trying to measure some of these interstellar distances.

Instead, astronomers make use of Lightyears. Lightyears are defined by the distance traveled by an object moving at the speed of light if it was moving constantly at that speed for one year.

This can properly be used to estimate interstellar distances. since its value is very large. 1 lightyear = 9,461,000,000,000 Km

If we say that our closest star is 9 lightyears away, we are saying that it will take an object moving at the speed of light 9 years to travel from that star to our planet.

7 0
3 years ago
2. Transcribe the following DNA segment 5’ agcgggatgagcgcatgtggcgcataactg3’ 3’ tcgccctactcgcgtacaccgcgtattgac5’ 3. Translate the
Ierofanga [76]
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'

adenine becomes uracil hope this helped :)
6 0
4 years ago
When you eat a hamburger, you are the: decomposer producer primary consumer secondary consumer tertiary consumer?
gavmur [86]
Tertiary consumer because you have no predators trying to eat you. You are at the top of the food web
6 0
4 years ago
How many chromosomes do human reproductive cells contain ?
9966 [12]

Answer:

23 chromosomes.

Explanation:

Human gametes have 23 chromosomes.Reproductive cells (gametes) are haploid - they have half the number of chromosomes as a body (somatic) cell. HOPE IT HELPS:)

3 0
3 years ago
Other questions:
  • All of the page please !!!
    5·2 answers
  • Which of the following statements must be *FALSE*?
    13·1 answer
  • A species of bacteria is antibiotic resistant. Out of 300 bacteria, 210 reproduce with this mutation. What percentage of the res
    5·2 answers
  • The vascular tissue that transports water and dissolved nutrients from the roots up through the plant is called
    8·1 answer
  • What do all codes, such as Morse code and Braille, have in common?
    9·2 answers
  • Tom is going to buy two hamsters. He wants to breed them and sell the baby hamsters to a local pet store. The store owner tells
    8·1 answer
  • Explain the cellular functions that occur when antibiotics attack a bacteria cell?<br><br>Thank you!
    11·1 answer
  • A researcher is interested in the effects of nitrate and phosphate on plant growth and sets up an experiment in which groups of
    13·1 answer
  • NEED ASAP
    8·1 answer
  • The viral pathogen that causes cold sores can remain inactive in the body for a long time between disease outbreaks. How is this
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!