Yes it will affect the ph level
Explanation:
The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.
1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.
2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.
3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.
In the given question, both promoter sequence are present in the 5'to 3'strand
3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA
The mRNA will be -
5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.
There are two start codon thus two polypeptides will be synthesized.
1. met-thr-asp-ala-val
2. met-thr-asp-val-ala-ser-ser
The process for connecting two monomers together is called dehydration synthesis. Dehydration means
“removal of water” and synthesis means “to join together”. So in this
process, two monomers are covalently bonded by the removal of a
water molecule. Each organic monomer has a hydroxyl group on
one side and a hydrogen on the other. When two monomers line
up side by side, they will have these two functional groups facing one
another. The H and the OH will break off of their respective
monomers and bond forming a water molecule. This is the dehydration
part of the process. Each monomer now has a carbon atom that needs
to covalently bond with something, so they bind to each other forming
a polymer. That is the synthesis part of the process.
