1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sophie [7]
3 years ago
13

How do dna molecules vary from one species to another?

Biology
1 answer:
Andru [333]3 years ago
3 0
<span>Organisms all possess DNA as their genetic material. What differentiates them (and their DNA) is the sequence of base-pairs within the DNA. The base-pairs are actually specific sequences of nucleotides (i.e. adenine , thymine, guanine and cytosine, labelled A, T, G, and C respectively) which encode genes. In other words, the DNA in each organism is made of these bases, but their sequences differ from organism to organism.</span>
You might be interested in
If you add lemon juice to soap will it affect the ph level
IRISSAK [1]
Yes it will affect the ph level 
4 0
3 years ago
Read 2 more answers
Find the prokaryotic promoter sequences; Draw boxes around them, Circle the start codon. Then transcribe the following DNA seque
Degger [83]

Explanation:

The transcription is a process which transcribe the DNA into a molecule which could be read by the machinery to translate it into the proteins and that molecule is known as the mRNA molecule.

1.The mRNA molecule is transcribed by an enzyme called RNA polymerase which transcribe DNA in 5'to 3'direction that is DNA strand will be 3' to 5'direction therefore the strand with 3' to 5' will act as template strand.

2. The RNA polymerase binds at promoter region and there are two sequences in prokaryotes at -35 end which is TTGACA and at -10 end which is TATAAT.

3. The translation begins after the start codon which is AUG therefore proteins will be synthesized after AUG.

In the given question, both promoter sequence are present in the 5'to 3'strand

3’GTAACTGTCGAACTACTGTCTACGTCATATTACGCTAATCGATACTGCCTGCATCGATCGTCGACTGCGGTCCGAA

The mRNA will be -

5'- CAUUGACAGCUUGAUGACAGAUGCAGUAUAAUGCGAUUAGCUAUGACGGACGUAGCUUAGCAGCUGACGCCAGGCUU-3'.

There are two start codon thus two polypeptides will be synthesized.

1. met-thr-asp-ala-val

2. met-thr-asp-val-ala-ser-ser

7 0
3 years ago
Which of the following weighing balances performs measurements in a closed compartment with no air currents to disturb measureme
Neko [114]
Hydraulic balance is the best choice
4 0
3 years ago
Cells assemble carbohydrates through dehydration synthesis which means a(n) what molecule is removed when the monomers are bonde
mr_godi [17]
The process for connecting two monomers together is called dehydration synthesis. Dehydration means “removal of water” and synthesis means “to join together”. So in this process, two monomers are covalently bonded by the removal of a water molecule. Each organic monomer has a hydroxyl group on one side and a hydrogen on the other. When two monomers line up side by side, they will have these two functional groups facing one another. The H and the OH will break off of their respective monomers and bond forming a water molecule. This is the dehydration part of the process. Each monomer now has a carbon atom that needs to covalently bond with something, so they bind to each other forming a polymer. That is the synthesis part of the process. 
6 0
3 years ago
Which will most likely affect a structure built on aa floodplain
Korvikt [17]
G, erosion by a river
4 0
3 years ago
Other questions:
  • Which of these is a possible risk associated with stem cell therapy? A) The host’s body could reject the transplanted stem cells
    14·2 answers
  • Why is water capable of forming a hydrogen bond
    7·1 answer
  • Which of the following is typically included in the count of total carbohydrates on a nutrition label?
    10·2 answers
  • The cell on the left maintains its shape with the support from _____. Select one: a. The cell wall b. The cytoskeleton c. Chromo
    6·2 answers
  • What country is most likely to be in stage 4 of population growth with a low birth rate and low death rate ?
    10·2 answers
  • Since oxygen gas is being released, it can be inferred
    7·1 answer
  • Which description accurately describes the cell membrane?
    5·1 answer
  • What are the sequence of events in the replication of DNA
    9·1 answer
  • How does Earth’s orbit affect the weather and climate?(1 point)
    12·2 answers
  • Could someone pls help me with biology?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!