1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
guapka [62]
3 years ago
5

The start gun goes off to signal the beginning of the race. Before the runners can interpret the meaning of the noise, however,

their sensory receptors must translate the sound waves into neural signals the brain can understand in a process called __________. a. sensation. b. perception. c. transduction. d. synesthesia.
Biology
1 answer:
Vilka [71]3 years ago
4 0

Answer:

B

Perception - which is the ability to receive and interpret information that reached the ears through their sensory receptors and must be translated from the sound waves into the neural signals for the brain.

You might be interested in
Bacteria cells have a rigid cell ____ that gives it its shape
kvasek [131]

Answer:

wall

Explanation:

It is composed of peptidoglycan. The wall gives the cell its shape and surrounds the cytoplasmic membrane, protecting it from the environment.

8 0
3 years ago
Which inner planet is the largest?
kramer
The inner planets are those that orbit closer to the sun: mercury, venus, earth and mars.

Attending to the size this is the increasing order: mercury, mars, venus and earth.

Earth is the largest of the inner plantes.
3 0
3 years ago
Read 2 more answers
Question 3
Contact [7]

High-density means full and low density is more empty

5 0
3 years ago
The mouth of the shark is part of which organ system?
crimeas [40]

Answer:

Oral cavity

Explanation:

its first organ from which food enter

8 0
2 years ago
Please help its due in a hour!!!!!
garri49 [273]

Answer:

1. The difference between the normal hemoglobin protein DNA sequence and the sickle cell hemoglobin DNA sequence is a base to base shift, in this case adenine (GAG) to thymine (GTG).

2. The difference affects the amino acid sequence of the protein by replacing glutamic acid (Glu) with valine (Val).

Explanation:

In sickle cell anemia, a change in the DNA nucleotide sequence is observed, where adenine is substituted by thymine, whose expression is the change in the amino acid sequence of globine β, incorporating valine instead of glutamic acid. This represents a molecular mutation - point mutation - by subtitution, which corresponds to missense mutation.

<u>Normal hemoglobin protein in a RBC</u>

DNA                 CTG ACT CCT GAG GAG AAG TCT

Amino acids     Leu  Thr   Pro   Glu   Glu   Lys   Ser

<u>Sickle cell hemoglobin protein in a RBC</u>

DNA                 CTG ACT CCT <em>GTG</em> GAG AAG TCT

Amino acids     Leu  Thr   Pro   <em>Val</em>   Glu   Lys   Ser

When GAG is transcribed to mRNA, the CUC codon is obtained, which codes for glutamic acid. Thymine substitution causes the DNA sequence to change to GTG, which is transcribed as CAC, the codon that encodes the amino acid valine. The <u>change from glutamic acid to valine in β-globin causes an altered hemoglobin, giving the abnormal erythrocytes observed in sickle cell disease</u>.

6 0
3 years ago
Other questions:
  • Which statement best distinguishes plant cells and animal Cells?
    13·2 answers
  • Jerry wants to start a small business producing jelly made from marine algae. What kind of algae should he select for this purpo
    9·1 answer
  • Why do you think neutrophils are not present in the tissues during homeostasis even though they constitutively express the selec
    13·1 answer
  • Which components of the atom have no charge? Question 3 options:
    9·2 answers
  • While doing field work in Madagascar, you discover a new dragonfly species that has either red(R) or clear(r) wings. Initial cro
    11·1 answer
  • Which of the following is a true statement?
    13·1 answer
  • A well tested concept that explains a wide range of observations. True or False
    14·1 answer
  • What impact do you think 3d printing could have on the future of science?​
    10·2 answers
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
  • Which step constitutes the power stroke of muscle contraction?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!