AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer:
B
Explanation:
An alkylating agent adds an alkyl group to the DNA strand of a specific cell group highly prone to being cancerous. This action is exactly what Cisplatin does by disrupting DNA replication (mitosis) for cancerous cells by inserting itself into a DNA strand.
The priority nursing intervention for this client is FOR THE NURSE TO TAKE CARE OF THE IMPAIRED GAS EXCHANGE.
Dyspnea is a medical condition in which the affected individuals have difficulty in breathing properly, that is, such individuals usually experience shortness of breath. Shortness of breath is one of the symptoms that are associated with heart failure. In the scenario given above, the first thing for the nurse to do is to ensure that the patient is breathing normally again, before setting out to take care of other things.
