Which substances are most used as building blocks of in the synthesis of lipids

Biology

1 answer:

swat323 years ago

5 0

Fatty acids

Explanation:

Fatty acids are the building blocks in the synthesis of lipids. Lipids are built on repeating fatty acids units.

Many esters occurs naturally in plants and animals.
Such as fats and oils, waxes, phospholipids and glycolipids.
These groups of compound are called lipids.
Fatty acids are alkanoic acids and when they combine with alkanals produce esters.
They are made up of the carboxylic acid functional group.

Learn more:

lipids brainly.com/question/5094081

#learnwithBrainly

You might be interested in

96 K = _____ -177°C 0°C 96°C 369°C

givi [52]

Answer:

-177ºC

Explanation:

96 K ≈ -177.15ºC

3 0

3 years ago

BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I

storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved