1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Greeley [361]
3 years ago
11

Why might (mostly) boneless creatures, like jellyfish, sea slugs, squid, and octopuses, fare especially well underwater? What is

it about the physics of being underwater that would allow relatively large, sometimes highly mobile creatures to flourish that isn’t true for boneless land creatures?
ASAP
Biology
1 answer:
vagabundo [1.1K]3 years ago
5 0

Answer:

The species that develop in aquatic environments, need to be able to have an adequate locomotion and according to the hydrostatic pressure in the water, which this pressure has the opposite direction to gravity in terrestrial life.

Explanation:

Vertebrates that have a skeleton are accustomed to gravitational forces, and this bone structure is what allows adequate locomotion to perform movements as a function of the force of earth's gravity, in water the force of gravity has no effect, since that the hydrostatic force predominates, which the direction is opposite to the gravitational forces.

Amorphous bodies, with few solid structures, not bony, make them better adapt to movements in water masses that are promoted by hydrostatic forces.

You might be interested in
Plssss help out study island
Harman [31]

Answer is A

Hope this helps

7 0
2 years ago
What electrons are used to form iconic and covalent bonds
Sever21 [200]

Answer:

Valence electrons, or the electrons that are farthest from the nucleus.

5 0
3 years ago
Which of the drugs (if either) was more successful in preventing the recurrence of depression relative to the placebo?
Alex17521 [72]
The results clearly reveal that Imipramine is by far more effective than Lithium in preventing the recurrence of depression. 62.16% of the patients taking Lithium had a recurrence of depression which is more than twice that of patients who took Imipramine (28.95%). 

The results also question the effectiveness of Lithium in general since the percentage of patients who had a recurrence of depression in the Placebo group (67.65%) is only slightly higher than that of the Lithium group (62.16%).
7 0
3 years ago
The following sequence of nucleotides is found in a single-stranded DNA template: ATTGCCACGTAGCTATCGTACG Assume that RNA polymer
quester [9]

Answer:

1) The right end is the 5' region and the left end is the 3' region

2) 5'-UAACGGUGCAUCGAUAGCAUGC-3

       

5 0
3 years ago
Which of the following describes characteristics of the stratosphere? A. has low air pressure, but high temperature B. contains
mojhsa [17]
Temperature increases with altitude 
3 0
2 years ago
Other questions:
  • Which element would most likely bond with lithium and form an ionic compound?
    7·2 answers
  • White-headed woodpeckers are adapted to have strong beaks that can break into tree trunks to find bugs and can also open pine co
    12·2 answers
  • Hello pls help I need answer
    15·1 answer
  • Infer why chloroplasts are found mostly in the leaves of plants.
    5·1 answer
  • Why did darwin stop at the island?
    13·1 answer
  • Please answer question below
    6·2 answers
  • Why is preventing pollution at its source the first strategy in minimizing environmental risk?
    5·2 answers
  • According to this food web, which of the following organisms do hawks eat?
    9·2 answers
  • A ________ is an educated guess based on relative information that has been collected.
    9·2 answers
  • Which trophic level in a food web contains the most energy?.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!