1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anika [276]
3 years ago
12

Could haemochromatosis also be caused by someone's environment?

Biology
1 answer:
Rainbow [258]3 years ago
8 0
Yes, if a person is to eat to much iron.  
You might be interested in
The rigid layer that is present in the cell walls of bacteria that is primarily responsible for the strength of the wall is know
melomori [17]
The substance that helps keep the integrity of the bacterial cell wall intact is known as the peptidoglycan. Others also refer to is it as murein or mucopeptide. The bacterial cell wall is necessary for survival because of the high internal pressure present inside of bacteria. Under normal conditions, if the cell wall is removed the bacterial cell will burst.

The peptidoglycan is a layer that can be used to distinguish gram positive bacteria from gram negative ones. G(+) bacteria have a thick layer of this while G(-) have a thinner ones.
4 0
3 years ago
How do you appreciate about organisation of cell in the living body?
tankabanditka [31]

Answer:

it will be helpful and like me

6 0
3 years ago
Why was natural selection an important contribution to the theory of evolution?
Lelu [443]

Answer:

Natural selection is an important contribution to the theory of evolution because it increases an individual's ability to survive and compete and reproduce.

Explanation:

3 0
2 years ago
I need help in class, I have one more to finish! Pls, help me, guys!
Ludmilka [50]

Answer:

If its dna replication: TTCATGCTATGCTACGTGTACGTACCGAT

If its transcription: UUCAYGCYAYGCYACGYGYACGYACCGAU

Explanation:

8 0
3 years ago
Melissa is getting ready for a party where she plans to serve grilled chicken and a raw vegetable salad. she washes her hands, t
vivado [14]
I would say that Melissa has made the mistake of using the same uncleaned cutting board first for cutting up chicken which is notorious for forming bacteria quickly when out of the fridge and then chopping vegetables on it thus running the possibility of contaminating the vegetables with chicken bacteria. She should ensure she washes the cutting board carefully with soap and water to avoid contamination of the vegetables.
4 0
3 years ago
Other questions:
  • What amino acid is specified by the codon of GCG, and will there be a change if the codon is changed to GCC?
    11·2 answers
  • D) out of the 16 possible outcomes how many have yellow leaves?
    15·1 answer
  • Why does more photosynthesis take place in the ocean than on land
    11·1 answer
  • What are three methods scientists use to study past climate conditions?<br> PLEASE HELP ME GDSJFD
    6·1 answer
  • Skeletal muscle is controlled by the organism.
    15·1 answer
  • What is cellular respiration and what are the three stages?
    6·1 answer
  • Please help ASAP i’ll give brain
    7·1 answer
  • Most of the air pollution in the news is the result of
    7·1 answer
  • Genetics problems can be solved by using logical steps.
    7·1 answer
  • Explain what distruptive selection is
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!