1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artemon [7]
3 years ago
7

2. Copy/paste and align the first 5 bases of all introns. Which bases are conserved near intron start ("donor site")?

Biology
1 answer:
Delicious77 [7]3 years ago
5 0

Answer:

This question is incomplete

Explanation:

Introns are non-coding regions of a DNA that removed by RNA splicing prior to translation. Alignment is usually done between sequences to see and understand the identity and similarity between two or more sequences.

A region/base is said to be conserved if there is  NO change in any base in that particular region. A multiple sequence alignment (MSA) can be used to align the donor sites of all the introns to see the bases that have not "changed" (and still remained in there exact position) hence conserved across all the donor sites.

NOTE: The donor site of an intron is the 5' end, thus the first five bases in the 5' end are to be used here

You might be interested in
Some beetles and flies have antler-like structures on their heads, much like male deer do. the existence of antlers in beetle, f
defon
<span>This is an example of convergent evolution. These animals gained these similar antler structures to be able to survive in similar environments. Convergent evolution gives organisms who are unrelated similar characteristics as they evolve. The characteristics are influenced by the organism's similar habitats and are given to them to make sure the organisms are able to adapt to survive.</span>
7 0
3 years ago
1. What is the basic ingredient of all clouds?
Andreas93 [3]
1. moisture/water
2. precipitation
3. evaporation
4.transpiration
5. warmer, more
6. vaporization
7. condensation nuclei
6 0
3 years ago
Read 2 more answers
What is the difference between chromosomes and sister chromatids in the m phase?
denpristay [2]

Answer:

Before cell division must occur, the chromosomes must replicate themselves. Sister chromatids are the two initially identical copies.

6 0
3 years ago
Thomas Malthus was an economist who influenced Darwin's developing theory of evolution. Malthus observed that the birthrate amon
sukhopar [10]

Answer:

The work of Thomas Malthus help and influence Darwin Thomas to refine his theory of natural selection by explaining that there is a meaningful competition between the individuals of a particular species or population for a specific resource such as food or shelter.

Thomas Malthus predicted that the human population is reproducing faster than its death race and will lead to growing faster than space and food supplies needed to sustain it. Darwin concluded further that If all offspring of almost any species survived for several generations, they would overrun the world and therefore a healthy and meaningful competition is present and to overcome this natural selection takes place as the individual adapt will ultimately survive.

4 0
3 years ago
How can energy and matter be cycled without oxygen?
irina [24]

Producers, which are the base of the food chain for ecosystems are essential and do not require oxygen to cycle energy and matter, as they create oxygen through photosynthesis.  Plants are producers that use this process to capture light energy and use it to convert carbon dioxide and water into an organic substance known as glucose.

7 0
4 years ago
Other questions:
  • Trh is a type of ________ hormone secreted by the ________.
    13·1 answer
  • Most biological macromolecules contains carbon, hydrogen and oxygen atoms. Which of these has the carbon, hydrogen and oxygen in
    15·2 answers
  • Which substances shown moves passively through the lipid part of the membrane?
    14·1 answer
  • How exactly did dawn brancheau die
    7·2 answers
  • If there are no differences between the amino acid sequences in the cytochrome c protein of humans and chimpanzees, why aren't w
    10·1 answer
  • Help please stuck on number <br><br>4 down<br>16 down <br>3 across
    13·2 answers
  • In the Periodic Table, the atomic number is equal to the number of
    9·2 answers
  • Write the code for RNA from this DNA STRAND :<br><br> AAAAAATTTTTTCCCGGGGTTTATATATC
    15·1 answer
  • What happens when air cools to its saturation point,and the Ayer vapor in the air condenses?
    10·1 answer
  • When a volcano erupts, particles of rock and ash are released into the atmosphere. After this, water droplets form around the ro
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!