1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
yulyashka [42]
3 years ago
11

Someone please help me ! what is a monomer?

Biology
2 answers:
STALIN [3.7K]3 years ago
8 0

Answer:

A monomer is a molecule that can react together with other monomer molecules to form a larger polymer chain or three-dimensional network in a process called polymerization.

Examples of the monomers are glucose, vinyl chloride, amino acids, and ethylene.

DENIUS [597]3 years ago
7 0
A molecule that can be bonded to other identical molecules to form a polymer.
You might be interested in
Would the liver cells that develop from the mutated cell have the same mutation
Anettt [7]
Yes because why a cell goes through mitosis the DNA is an exact replica, there forever having the same mutations
3 0
2 years ago
What does a trace fossil look like?​
Arisa [49]

Answer:

Trace fossils include footprints, trails, burrows, feeding marks, and resting marks.

Explanation:

6 0
3 years ago
What is a solstice?
nevsk [136]

Answer:

4 or D

Hope it’s right ;)

5 0
2 years ago
Read 2 more answers
A biologist found an asymmetrical organism. A part of the organism was injured, but it was able to repair itself through regener
natulia [17]

Answer:

Because the organism is asymmetrical and it was able to regenerate, it’s probably (an amphibian), and belongs to the phylum (Mollusca).

5 0
2 years ago
What type of molecule is produced by the ribosome?
-Dominant- [34]

Answer:

The correct answer is - C. protein.

Explanation:

Ribosomes are biological molecules that are made up of RNA and proteins. These molecules produce protein molecules with the help of mRNA by the process of translation. These molecules are called the factory of protein or protein synthesis site.

The RNA that is present in these molecules is ribosomal RNA. These are attached to the other cell organelles called endoplasmic reticulum used the protein to check and modify them.

8 0
3 years ago
Other questions:
  • What caused Pangaea to break up?
    11·2 answers
  • Which statement is NOT true about the universe? A) Stars have the same brightness, color, and mass. B) New stars and galaxies ar
    13·2 answers
  • Calcium has an atomic number of 20 and an atomic mass (weight) of 40. Therefore, we know that calcium has
    10·2 answers
  • __________ constitutes about 80% of circulating antibodies in plasma.
    6·1 answer
  • Which animals is waiting for the wildebeests as they cross the Grumeti River? Which animals are waiting for them when they retur
    5·1 answer
  • Which is a conclusion drawn from the observed DNA similarities found between apes and chimpanzees?
    9·1 answer
  • 5. Which is an example of an epidemic?
    15·1 answer
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • 2. What new realizations do you have about solving problems involving sequence? How would you connect this to real life? How wou
    10·1 answer
  • How has our throw away consumer lifestyle affected the environment?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!