1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fofino [41]
3 years ago
7

Tiny river has recently been experiencing increasing erosion of the sediment along its banks. what could explain why this is hap

pening.
A. decreased Slope
B. Increased Runoff
C. decreased rainfall
D. increased vegetation

Please help, Thanks! ​
Biology
1 answer:
iren2701 [21]3 years ago
6 0

Answer:

The best explanation for why tiny river has recently been experiencing increasing erosion of the sediment along its banks is increased runoff.

Explanation:

The main agents of soil erosion are wind, climate change, ice and water circulation.

Runoff is caused by precipitation, which is capable of produce erosion on the banks of a river, with some negative consequences for the environment.

Runoff depends on the flow of water, coming from rainfall, which moves across the surface of the soil, with great capacity for infiltration and erosion. In this case, runoff is the only possible cause of soil erosion

With respect to the other options:

<em>Decreased Slope , decreased rainfall  and increased vegetation are not factors related to the erosion in the bank of a river. </em>

You might be interested in
In science Observation and experimentation correlate with what aspects of critical thinking
Leokris [45]

Answer:

The critic thinking

which may be defined by (the ability to verify assumptions, ideas, are they real, or bear part of the truth, or are they unreal) and may be defined as "reasonable contemplative thinking that focuses on what the individual believes or performs." It is an examination and evaluation of the solutions offered in order to make a judgment about the value of the thing

4 0
3 years ago
How does a diversity of organisms increase the chances that some will survive a major change in environment ?
Slav-nsk [51]
<h2>Answer:</h2>

This can be explained with an example.

Let’s lake an example of two species 1 and 2.

Species 1 has a wide genetic diversity due to which organism are also diverse in phenotype. Their phenotype are:  

Black, dark brown, brown, dark red, red, light red, pink, skin color.

From left to right organism are becoming less adapted to high temperature relatively.

For species 2:  This species has less genetic diversity and its phenotypic diversity is as follow:

Black, red, Skin color.

From left to right organism are becoming less adapted to high temperature relatively.

Now if there is the sudden high temperature in the environment; 4 Types of phenotype will survive are black, dark brown, brown, dark red.

While there will only two types of organism in specie 2 which will survive are black, red.

So that’s how the diversity of organisms increase the chances that some will survive a major change in environment.


7 0
3 years ago
Hypocalcemia stimulates __________. A. secretion of renin B. an increase in blood urea nitrogen C. a decrease in aldosterone pro
Lubov Fominskaja [6]

Answer:

D. secretion of parathyroid hormone

Explanation:

3 0
2 years ago
I NEED HELP WORTH 38<br><br> With a justification please
Arisa [49]

Answer:just do you work

Explanation:

thats what i do

8 0
3 years ago
A classic example of wildlife mismanagement is the North American bison, which was brought close to extinction in the 19th centu
umka2103 [35]

C

don't take my word for it but it's most likely C

4 0
3 years ago
Read 2 more answers
Other questions:
  • Plants are green because they contain the protein chlorophyll. A bucket was left on the lawn for one week. When the bucket was r
    7·1 answer
  • What is the difference between an environment and an ecosystem
    9·1 answer
  • What happens when a environment changes​
    6·1 answer
  • How do wetlands improve water quality in an ecosystem? A) Wetlands have filter feeders that clean the water. B) Wetlands have mi
    15·2 answers
  • Write the tRNA sequence for the given strand of mRNA<br> AGGUCAUGCAUGGGCAUGCAU
    6·1 answer
  • Question 17
    8·1 answer
  • How do liver and the pancreas aid in the digestive process?
    10·1 answer
  • If we cross Surface fish (have eyes and are not albino) with fish from Cave Scarlet, the F1 progeny have eyes and are not albino
    5·1 answer
  • Is this true? Living things can be studied at different levels of organization, from the molecule level to the largest level, th
    11·1 answer
  • the resources and conditions such as food water and climate that need to be present for a species to survive are known as
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!