1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
nlexa [21]
3 years ago
13

What happens to breathing rate with increase in Temp?

Biology
2 answers:
Savatey [412]3 years ago
5 0

Answer:

The breathing rate increases.

bixtya [17]3 years ago
5 0
It increases hope this helped you.
You might be interested in
Iguanas are living in a relatively dry habitat. Imagine a change in the iguana's habitat from dry land to aquatic. Based on the
Sav [38]

Due to Natural Selection, it is likely that the allelic frequency would change to favor iguanas with webbed feet. Those animals with webbed feet would have an easier time navigating their environment, which gives them an advantage over those that do not. Hope this helped!

4 0
3 years ago
In terms of processing in the nervous system, explain why your reaction time was most likely faster for the simple reaction task
madreJ [45]
In terms of processing in the nervous system, the reactio<span>n was faster for the more simple tasks because it required less processing and therefore small amount of neurons had to travel through out nerve system because our frontal lobe had less delay since there was less to think about.</span>
3 0
3 years ago
Match the steps in the cell cycle in the correct order
Tcecarenko [31]

Answer:

1. Chromosomes line up - metaphase

2. Cell growth - G1

3. Final preparations for division - G2

4. Chromosomes get pulled apart - anaphase

5. DNA replication - S

6. Chromosomes condense - prophase

7. Chromosomes uncoil and nucleus reforms - telophase

8. The cytoplasm and organelles divide, and now there are two identical cells - cytokinesis

Explanation:

There are four primary phases, or stages, in the cell cycle, which is a systematic process. Each stage has a goal that has to be achieved before moving on to the next. G1, S, G2, and mitosis are the stages.
There is growth during the G1 phase. A lot of protein is produced and water is pumped in, increasing the volume of the cell. The DNA is also examined at this time to see whether there has been any damage. The G1 phase precedes the S phase, therefore before going into S phase, the cell must make sure it has enough energy reserves.

The cell duplicates its DNA during the synthesis phase, also known as the S phase. DNA content doubles due to the duplication of all chromosomes. The compact state of DNA is created by proteins, which do not exist in and of themselves. Therefore, in order to ensure that the new DNA is properly packed when DNA is replicated, new packaging proteins must be produced. Histones are the proteins that house DNA. The production of new DNA is closely linked to the production of new histones.

A cell multiplies its organelles during the G2 phase. Right before the cells divide into two distinct cells during mitosis, the G2 phase occurs. There must be distinct functioning organelles in each daughter cell. Organelles like the golgi and endoplasmic reticulum are linked networks of sizable membrane pouches that may change size. Other organelles, including mitochondria and chloroplasts, are separate structures that must separate similarly to how cells do.

The process of physically dividing a cell into two daughter cells is called mitosis. Prophase, metaphase, anaphase, and telophase are its four basic stages. The nuclear membrane deteriorates as the chromosomes thicken during prophase. The center of the cell's chromosomes align during metaphase. One chromosome splits in half during anaphase, sending one half to either side. The telophase is characterized by the pinching together of the cell's centre to form two separate cells.

6 0
2 years ago
Distilled water is _____ or _______ to the solution inside a cell
fgiga [73]

Answer:

hypertonic or hypotonic

Explanation:

5 0
2 years ago
Read 2 more answers
Nicotine replacement and self-management techniques are two approaches to smoking__________________.
bija089 [108]

Answer:

It requires trolling your friends skills

7 0
3 years ago
Other questions:
  • When was Magna Carta written
    9·2 answers
  • Wegener believed that the continents were once together in one huge land mass. What was the name he gave to that large supercont
    6·2 answers
  • Papillary muscles prevent the AV valves from prolapsing (bulging) excessively into the atria when the ventricles contract. True
    12·1 answer
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • What are the products of photosynthesis? .-.
    11·1 answer
  • Add a brief description of stem cell division <br> my assignment is due in 30 minutes PLS HELP!!!
    11·1 answer
  • I've been looking around for the answer in this interactive website that was included within to answer these questions but, I co
    10·1 answer
  • Functional and structural unit of the living organism
    8·1 answer
  • List 2 type of particles in the air and example how they move
    13·1 answer
  • How to do a dichotomous key
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!