1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kap26 [50]
3 years ago
10

On microscopic examination, John observed yeast cells dividing into daughter cells. What type of asexual reproduction does this

represent?
A. fragmentation
B. Budding
C. Fission
Biology
1 answer:
KATRIN_1 [288]3 years ago
8 0
 The type of asexual reproduction  which is being represented is definitely C. Fission, because according to the data above the entity has divided into two or more parts which is a characteristics for the fission.
You might be interested in
Help pls its really quick literally Imbo
dezoksy [38]

I think is D Carbon dioxide

PLEASE MARK ME AS BRAINLIEST

7 0
3 years ago
A small population of chimpanzees lives in a habitat that undergoes no changes for a long period how old Gentic drift probably a
Travka [436]
It will reduce genetic diversity, I believe so 
5 0
3 years ago
The adrenal glands produce hormones that impact short-term responses, including fear and anger.
xz_007 [3.2K]

Answer:

Epinephrine, also known as Adrenaline

Explanation:

Adrenaline impacts short-term mood and can take seconds to flood your system.

*it may also be cortisol, I'm not sure if there's more context. Cortisol takes longer to work and can have long-term effects.

6 0
3 years ago
What types of molecules may not need transport proteins to be able to cross cytoplasmic membranes?
frozen [14]

The correct answer is small hydrophobic molecules.

The smaller the molecule and the more hydrophobic, or nonpolar, it is, the more rapidly it will diffuse across a membrane. It is because of the composition of membrane (lipid bilayer). By contrast, membrane is highly impermeable to charged molecules (ions), no matter how small they are.


4 0
4 years ago
Why do antibodies allow scientists to target and identify specific disease agents?
masha68 [24]
Antibodies bind to the antigens on the surface of disease agents. If some sort of fluorescent tag is added to the antibody it would make the disease agent be identifiable either under a microscope or with other Instruments because it would bind to the antigens on the surface of the disease agents and make them glow a certain color. I hope that this is the answer that you were looking for and it has helped you.
6 0
3 years ago
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • What is pharybx and its function ​
    5·2 answers
  • He light colored rock pocket mice in New Mexico blend in with the sandy soil of the area, but on darker lava flow, the light col
    10·2 answers
  • The question is: What is the relative age of layer 3? (Hint: With what absolute ages can you compare it?)
    13·1 answer
  • Which of the following defines evolution?
    9·1 answer
  • In which state of matter are particles most distant from one another
    8·2 answers
  • Hi everyone! It would be really really awesome if you could help me with my hw. I’m super confused. I’m supposed to find 10 mist
    13·1 answer
  • Help me out with this​
    6·1 answer
  • This is for today help me pls!!
    10·1 answer
  • When you practice good nutrition, you
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!