Answer:run over with ice to make sure hes okay
Explanation:
True, when succession occurs after a disaster, like a wild fire, its called secondary succession.
Secondary succession occurs when an existing population has been reduced due to a fire. So that it occurs on soil that was already present prior to the disaster.
<span>1) regulation of enzyme activity. 2) regulation of enzyme production.</span>
<span>3’ tcgccctactcgcgtacaccgcgtattgac 5’ </span>turns into:
5' agcgggaugagcgcauguggcgauaacug 3'
adenine becomes uracil hope this helped :)
Answer: Option B
Explanation:
The Eukaryotes, Bacteria and Archaea were firstly thought to be belonging to same kingdom as their characters were very much similar.
Until their DNA sequence were used as a basis of their distinction they were put into similar criteria. Due to advanced research their DNA sequence were analyzed and then it was found that the three organism are different.
So, the correct answer is option B
