1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fiesta28 [93]
3 years ago
5

Every cell has ______ that allows it to maintain a cellular environment that is separate from the environment in which it is fou

nd
Biology
1 answer:
valina [46]3 years ago
7 0

Answer:

energy

Explanation:

You might be interested in
A certain segment of DNA can be used as a molecular clock. Its rate of mutation is one mutation per 20 million years. Examine th
IgorC [24]
Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.

Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT

These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
5 0
3 years ago
How do human activities lead to primary succession?
Leni [432]

Answer:

This succession is influenced by environmental factors such as soil type, water regimes, vegetation history, climate, and invasive species. Humans affect all of these factors. The human dimension introduces the greatest amount of unknown variability. Forest lands are under increasing development pressure.

4 0
2 years ago
Name the type of skeletal tissue found in the ear flap.
ExtremeBDS [4]
Cartilage is the answer
4 0
3 years ago
Read 2 more answers
What are all living things composed of?
notka56 [123]

Answer:There are four types of complex carbon-based molecules in all living organisms: proteins, carbohydrates, lipids, and nucleic acids

Explanation:Cells are the basic building blocks of living things. The human body is composed of trillions of cells, all with their own specialised function

5 0
2 years ago
Read 2 more answers
The presence of myelin allows an axon to
Reptile [31]
The presences of myelin allows an axon to conduct their signals rapidly
4 0
3 years ago
Other questions:
  • What is the general name for the first species to grow after a volcanic eruption covers an area with lava?
    8·1 answer
  • Identify the stages in the eukaryotic cell cycle, describe their principal events, and point out some ways in which the cycle is
    12·1 answer
  • What is true of a substrate?
    12·1 answer
  • 05.01 LC Which observation supports the inference that humans and chimpanzees share a common ancestor?
    12·1 answer
  • Another students says that the earth’s magnetic poles have flipped many times in the past. How would you evaluate their statemen
    7·1 answer
  • The curve on the left shows the height of a population of penguins. The curve on the right shows the population five years later
    6·2 answers
  • Formulate a question that could be answered observing chromosomes of different species of animals
    14·1 answer
  • Give one example of a transverse wave and one example of a compressional wave. How are they similar and different?
    8·1 answer
  • M. magneticum can only survive in low-oxygen environments, which are typically found near the bottom of bodies of water.
    12·1 answer
  • What condition results in magma cooling and forming a “glassy” igneous rock?
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!