1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tasya [4]
3 years ago
10

The biomimetic design process includes each of the following steps:

Biology
1 answer:
Lina20 [59]3 years ago
8 0

This Question is not complete

The complete question is below:

The biomimetic design process includes each of the following steps:

1. Identify specific function to be developed

2. Gathering the material

3. Classifying the material

4. Imitating nature

5.

6. Final design

The missing step 5 involves which of the following activity?

Select one

a. Technology assessment

b. Economic optimization

c. Marketing analysis

d. FDA approval process

Answer:

Option a. Technology assessment

Explanation:

Biomimetic design can be defined the technological devices that have been created by man to mimic or copy the biological processes that takes place it the human body.

Biomimetic design inspiration comes from nature.

Biomimetic is a very important tool that is very useful in the medical field, in robotics, nanotechnology e.tc.

Application of biomimetic include:

a. The design of an electric nose, which can be used to help people to lack the ability to smell.

b. The design of prosthetics such as robotic arms and legs for people who have lost the their arms and legs.

c. They are used in nanotechnology to create very tiny antibodies(nanorobotic antibodies) that can be used to fight diseases in the body.

You might be interested in
During periods of intense activity, when glycolysis is used in the generation of atp, the reaction lies to the right, decreasing
umka21 [38]

Adenosine monophosphate (AMP) is a regulatory molecule in metabolic processes such as glycolysis and gluconeogenesis. For example, it stimulates the glycolytic enzyme phosphofructokinase, and therefore ATP production, and it inhibits the gluconeogenic enzyme fructose 1,6-bisphosphatase. Adenylate kinase catalyzes the reversible reaction shown here:


2ADP --> ATP + AMP


During periods of intense activity, when glycolysis is used in the generation of ATP, the reaction lies to the right, decreasing [ADP], generating ATP, and accumulating AMP. However, [ATP] is usually much greater than [ADP], and [ADP] is greater than [AMP].


Determine [AMP] when 3% of the ATP in a hypothetical cell is hydrolyzed to ADP.


<span>In this cell, the initial concentration of ATP is 265 ?M, and the total adenine nucleotide concentration (the concentration of ATP, ADP, and AMP) is 368 ?M. The equilibrium constant K is 0.82</span>

<span>
</span>

4 0
4 years ago
When the solution contains the same number of particles as what’s in the cell ______________
Setler79 [48]

Answer:

isotonic solution

Explanation:

8 0
3 years ago
Plato help pleaseeeeeeeeee
Ksju [112]
I believe the correct response would be B. Since of evolution were to occur, the possibility of the geographically isolated snakes to reproduce would be 0. Since the gene pool or the collection of all the genes in the population were to change and as a result of future reproductions of the 2 populations over time, transmission of specific genes that code for traits were to be specific for that population, ultimately not allowing them to reproduce.
6 0
3 years ago
CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
miss Akunina [59]
A because like what even is this??
4 0
3 years ago
What happens during cytokinesis?
iris [78.8K]
The cytoplasm splits in two and the cell divides
3 0
4 years ago
Read 2 more answers
Other questions:
  • What type of organism is a one-celled organism that functions as a single unit?
    14·2 answers
  • One way bacteria are important to the Earth and its ecosystems is that
    7·1 answer
  • In most stable freshwater environments, populations of Daphnia are almost entirely female and reproduce asexually. However, male
    9·1 answer
  • Explaining of matter when it is heated known as
    12·2 answers
  • Two major dissolved gases in ocean water are
    8·2 answers
  • Select the layers of the atmosphere that decrease in temperature as the altitude (height) increases. (Pick 2 Answers)
    15·2 answers
  • Which structure is labeled X in the diagram below?
    6·1 answer
  • What is the combination of alleles that you can see called?
    6·1 answer
  • Why tides<br> can be a<br> reliable &amp;<br> predictable<br> source of<br> energy?
    15·1 answer
  • This part of the brain is responsible for essential survival functions such as breathing and heart rate.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!