A representation of earths rounded surface on a flat surface is called___a map.
Answer:
hey talking for what-------
Well, basically when it says that the strand of mRNA is the opposite to DNA it means that the nitrogenous bases of DNA complement or follow base pairing rules to form the strand of mRNA.
In mRNA
A - U
G - C
T - thymine is absent and is replaced with U - uracil in mRNA.
The thymine bases in DNA are base paired with A - adenine in the mRNA strand.
So the mRNA strand would be the following :
AUGUGGGCUACGCGAGCUUCAUACGAUCUAGCUACGCAGUGGCAGCAGGCAUCACAUCGAUCGCAUUAG.
So, now that we know that this is the mRNA strand, and assuming that the top or the first part is the 5' region and the final end of the mRNA is the 3' region
Group three 3 nucleotides together in the mRNA strand and find the amino acid that the first 3 would represent in this case AUG would represent the start codon or methionine in this case it would be the start, the next would be UGG, etc, do this until you reach the final set of 3 nucleotides and the final product would be a protein consisting of whatever other amino acids were represented by the codon or 1 set of 3 nucleotides on the mRNA strand.
Answer:
Azimuthal map projections
Explanation:
The Azimuthal map projections come in a circular shape. They represent the whole world but in a different manner than that of the other map projections. The other map projections tend to have problems with the size of the objects as they get further away from the Equator, but this map projection doesn't have that problem. The Azimuthal map projections actually represent all of the places on Earth with their correct distances from the central point, and they all have their sizes correct proportionally to the scale, thus making an accurate map projection.
The three main stages of cellular respiration (aerobic) would include Glycolysis in the cytoplasm, the Kreb's Cycle in the Mitochondrial Matrix and the Electron Transport Chain in the Mitochondrial Membrane.
