1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kaheart [24]
3 years ago
5

Part 1: CCATAGCACGTTACAACGTGAAGGTAA

Biology
1 answer:
Nataly [62]3 years ago
5 0
RNA--GGUAUCGUGCAAUGUUGCACUUCCAUU
You might be interested in
Guanto e 590×3 arme e efetue​
zlopas [31]

Answer:

1770

Explanation MATH

3 0
3 years ago
Please help stuck on part c
tangare [24]
Mitochondria is the power house of the cell (also pay attention in class)
6 0
3 years ago
A scientist is studying a cross between plants that are heterozygous (Xx) for a certain trait. She will use a table similar to t
svetoff [14.1K]
How many characteristic traits are there??
7 0
3 years ago
Read 2 more answers
Help. will give brainliest answer!!!!!
Yakvenalex [24]
B is the answer to your question


7 0
4 years ago
Is a butterfly more closely related to a worm or a bird? why?
natita [175]
Bird, for both can fly
7 0
3 years ago
Read 2 more answers
Other questions:
  • What is the result of algae in corals dying?
    15·1 answer
  • HURRY PLEASE 30 POINTS
    12·1 answer
  • Geoscientists use ___________ to explore the deep layers of the earth that humans can not yet dig down into.
    8·1 answer
  • What part of a cactus does photosynthesis occur?
    15·1 answer
  • What are the functions of Proteins?
    11·1 answer
  • What is the universe composed of ?​
    12·2 answers
  • How do the evolutionary chart and the video support the claim that all living things are made up of cells
    10·2 answers
  • Which cell structure is the gatekeeper, controlling what goes in and out of the cell?
    12·1 answer
  • Hi I really need help!! :)
    6·2 answers
  • Thirteen different SSR loci are used by the FBI to perform DNA fingerprinting. If SNP loci were assayed instead to identify indi
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!