1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ANTONII [103]
3 years ago
6

Help. will give brainliest answer!!!!!

Biology
1 answer:
Yakvenalex [24]3 years ago
7 0
B is the answer to your question


You might be interested in
Within a population of fish, ____________ exists in the form of body color. Some fish are orange and some fish are red.
kumpel [21]
In populations of all living things, there is a variation of different traits. This is important for the process of evolution and natural selection because if the individuals in the population vary in size, shape, color or any other morphological or physiological trait, the individuals can be more or less successful because of them and therefore natural selection can filter the variations that are the fittest for that environment.
6 0
3 years ago
Read 2 more answers
A disease involving a virus that attacks the nervous system and often results in paralysis is:
zubka84 [21]
The answer is Poliomyelitis. Poliomyelitis or also called as Polio, is a kind of disease involving a virus known as polio-virus that attacks the different parts of the nervous system that results to the paralysis of limbs or different parts of the body.

6 0
3 years ago
Vultures and Hyenas are<br><br> herbivores<br> carnivores<br> omnivores<br> scavengers
Ymorist [56]
Hello :))

The answer to this question is:
Scavengers 

I hope this helps!
Good Day :D
6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Which image shows labeled organelles that are present ONLY in plant cells?
daser333 [38]

Answer:

The answer would be A, only chloroplasts and vacuoles are found in plant cells. :)

4 0
3 years ago
Read 2 more answers
Other questions:
  • What type of asexual reproduction where offspring grows out of the body of the parent?
    11·1 answer
  • Which of the following activities contribute most to climate change?
    8·2 answers
  • What is a supercell???
    11·2 answers
  • Which term describes the rearrangement of genes that causes an organism's genes to differ from those of its parents?
    9·2 answers
  • What are three real-life examples of genetic engineering that are occurring right now?
    5·1 answer
  • What always occurs when energy moves from one trophic level to the next higher one?
    10·1 answer
  • ¿Cuál organismo dio origen a todos los seres vivos que existen?
    9·1 answer
  • In which areas of the brain would a stroke mimic damage to cranial nerve 2
    12·1 answer
  • Most plants have what type of photoperiodism?
    11·1 answer
  • 1. List four sensations detected by the tactile receptors in the skin in the spaces below:
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!