1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Darya [45]
3 years ago
14

When genes are transferred from one individual to another other than through mating, it is referred to as

Biology
1 answer:
dexar [7]3 years ago
6 0

Answer:

Sexual reproduction

Explanation:

You might be interested in
Which of these refers specifically to a stiffening of the arteries, which in turn restricts blood flow? A) AIDS B) cardiotitus C
Arte-miy333 [17]
Arteriosclerosis that is the answer
3 0
4 years ago
If a molecule of DNA has 30% Adenine how much of the other bases will be present?
anygoal [31]

Answer:

If a DNA molecule has 30% Adenine the percentage of the other bases is Thymine: 30% Cytosine: 20% Guanine: 20%.

Explanation:

When the percentage that a base has in a DNA molecule is given, the percentage of the other bases can be known using the Chargaff's base pair rule.

A DNA molecule has the information of the genome of a living being, according to a specific sequence of its nitrogenous bases adenine, guanine, cytosine and thymine.

Chargaff was able to establish that in a DNA molecule the ratio of purine : pyrimidine of 1:1, so there must be the same amount of thymine as adenine and a similar amount of guanine for the cytosine, taking into account the complementarity of bases.

Taking into account the law of the base pair, if in a DNA chain there is 30% of Adenine, in the molecule there is:

  • <em>Adenine 30%. </em>
  • <em>Thymine 30%. </em>
  • <em>Cytosine 20%. </em>
  • <em>Guanine 20%. </em>
  • <em>Total ..... 100% </em>

In this case, the <u>Chargaff rule is useful to determine the percentage of nitrogenous bases that exist in a DNA molecule, knowing the percentage of a single base</u>.

7 0
3 years ago
What iS one reason scientists have a developed a system to classify organisms?
Fantom [35]

• Classification allows for organisms to interbreed and change.

• A system was needed to better track genetic changes in an organism.

Classification allows for better identification of new organisms.

A system was needed to see microscopic organisms with more detail.

8 0
3 years ago
Describe how heat is generated using one non-renewable resource such as coal, natural gas, or oil.
Lyrx [107]
The heat is generated using non-renewable resources such as coal, natural gas, or/ and oil. This is the cause because the natural process of heat comes through these given variety of generators ways.
5 0
3 years ago
Read 2 more answers
Amanda notices a tree is brown, has a rough texture, and is solid. although individually these characteristics do not define a t
erastova [34]

The brain's interpretation of raw sensory inputs is known as Perception.

Here, when Amanda notices a tree which is brown, has a rough texture, and is solid. Although individually these characteristics do not define a tree, when combined, they do. So, perceptual binding process allows her to identify the object as a tree.

Perceptual binding is the process of merging individual bits of sensory information into logical representations.

4 0
4 years ago
Read 2 more answers
Other questions:
  • The _____________ has (have) a large role in the regulation of blood pressure.
    11·1 answer
  • True or False?<br> Most of the energy resources used to generate electricity are renewable
    14·2 answers
  • A college's nursing program has added an elective in forensic nursing to the curriculum. Which phenomenon underlies the expanded
    10·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • 5. What are some safety precautions that you<br> should follow when working in the laboratory
    6·1 answer
  • PLEASE HELP! How does nature make someone feel better in times of stress?
    11·1 answer
  • Change the following sequence (GGAUUC) to show:
    12·1 answer
  • Which of the following describes a collection of specialized organs?
    9·1 answer
  • What is adenine and thymine?​
    11·1 answer
  • Sedimentary rocks with ripple marks suggest that the rocks formed
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!