1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tema [17]
3 years ago
11

Typically, acetylation of histone tails leads to ________. Typically, acetylation of histone tails leads to ________. relaxed pa

ckaging of the chromatin and increased transcription activation of topoisomerase removal of the protein components of the chromatin from the DNA tighter packaging of the chromatin and reduced transcription increased amounts of euchromatin relative to heterochromatin
Biology
1 answer:
ololo11 [35]3 years ago
6 0

Answer:

relaxed packaging of the chromatin and increased transcription.

Explanation:

Genetics can be defined as the scientific study of hereditary in living organisms such as humans, animals and plants.

A nucleotide can be defined as an organic molecule which forms the building block of nucleic acid such as deoxyribonucleic acid (DNA) and ribonucleic acid (RNA).

Basically, nucleotide comprises of the following parts;

1. Nitrogenous base: this includes adenine (A), thymine (T), guanine (G), and cytosine (C) which are mainly found in the DNA while adenine (A), guanine (G), uracil (U) and cytosine (C) are found in the RNA.

2. A phosphate group.

3. A penrose sugar: it is either deoxyribose in DNA or ribose in RNA.

The two parts or chemical components of a nucleotide which do not change throughout the structure of DNA are;

I. Five-Carbon Sugar also known as deoxyribose and it has hydrogen on its second carbon.

II. Phosphate: this is the structural backbone that provides support to DNA.

Histones are a group of highly basic proteins that are mainly associated with deoxyribonucleic acid (DNA) in the nucleus of a living organism and are responsible for condensing it to chromatin.

Typically, acetylation of histone tails leads to relaxed packaging of the chromatin and increased transcription.

Transcription can be defined as a process which typically involves re-writing the informations contained within a Deoxyribonucleic Acid (DNA) into a Ribonucleic Acid (RNA) by enzyme RNA polymerase.

You might be interested in
What type of power does this structure produce?
Harlamova29_29 [7]

Answer:

D. Hydroelectric

Explanation:

The given structure is of a dam where Hydroelectricity is produced.

6 0
3 years ago
Read 2 more answers
The most commonly reported symptom of withdrawal from caffeine is __________.
Assoli18 [71]
Headache and Fatigue.

Good luck! (:
5 0
3 years ago
What chemical substances needed by body cells that result from the process of digestion is called
just olya [345]
The answer is nutrients.

Nutrients nourish the body by providing it with energy and/or contributing to the body's metabolic processes. Nutrients come from food in the form of carbs, fats, and protein, all of which need to be digested by the body before it can use these nutrients.
4 0
3 years ago
TCAGGCATTTACGACTCG complemetry strand
katrin2010 [14]
What can u explain more ur question
5 0
3 years ago
Read 2 more answers
Feather color in budgies is determined by two different genes, y and b, one for pigment on the outside and one for the inside of
Thepotemich [5.8K]

Answer:

bbbb and ybyb

Explanation:

Since blue is dominant and white is recessive,, one blue present will result in blue feathers. byyy will also result in a blue bird.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Cellular respiration occurs within the _________ of a cell.
    8·2 answers
  • What is the name of the enzyme that adds nucleotides to the new strand of dna during replication, thereby building a new strand?
    12·1 answer
  • A wolf's diploid number of chromosomes is 78. How would the number of chromosomes in the wolf's body cells compare to the number
    10·1 answer
  • Heart rate, digestion, breathing, and perspiration are all controlled by which part of the peripheral nervous system?
    7·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Enzymes in the mouth, stomach, and small intestine help in the chemical digestion of food.
    14·1 answer
  • Photo attached!!!!!!!!!!!!!!
    7·1 answer
  • What is the term for a condition whereby small amounts of urine leak from a bladder that is always full as a result of a spinal
    15·1 answer
  • during the process of cellular respiration, energy is released from(1)Carbon dioxide (2) Oxygen atoms(3)Water molecules (4) chem
    6·2 answers
  • which explanations accurately describe how cell structures interact in order to maintain homeostasis? select all that apply.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!