1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tpy6a [65]
3 years ago
15

Uses for genetic engineering include: selet all that applys

Biology
1 answer:
jok3333 [9.3K]3 years ago
4 0

Answer:

Uses of genetic engineering include:

increasing plant food production

improving medical treatment

Explanation:

Genetic engineering can be described as a technique in which the genome of an organism is manipulated for the benefit of humankind. The processes of genetic engineering involved the manipulation of the plants and animals DNA so that they will be able to produce more better characteristics. Also, drugs such as vaccines can be produced in animals by the techniques of genetic engineering.

You might be interested in
The membrane structures that make up the cell are called
BlackZzzverrR [31]
B organelles
Like the mitochondria
7 0
3 years ago
The study of psychoneuroimmunology suggests that when a stressful situation is encountered, several biological reactions occur,
zhenek [66]

Answer: d) lightheadedness or unconscious episodes.

Explanation:

There are several ways the body responds to stress but one method used by psychologists to measure this response is Hans Selye's general adaptation syndrome. This occurs in 3 stages:

1. The alarm reaction. This occurs when the stressor is first presented resulting in the RELEASE OF HORMONES from the adrenal gland into the blood stream. The hormone in turn cause sympathetic nervous system activation and increase energy levels, INCREASE RESPIRATION, increase muscle tension, reduce sensitivity to pain, slow down the digestive system, and cause a RISE IN BLOOD PRESSURE.

2. The stage of resistance- this occurs till the stress is removed.

3. The stage of exhaustion

7 0
2 years ago
Read 2 more answers
Which of the following involves spores of the same size?
Kisachek [45]
I believe the answer to this is Both
3 0
3 years ago
Read 2 more answers
Which of these is a provisioning service— a benefit that is obtained directly from the environment?
dsp73

I believe it is either B or A, personally i'm leaning towards B, but at the same time, i don't think that we would be obtaining materials via pollination, so it then causes A to make more sense.

7 0
3 years ago
Read 2 more answers
Mutations can lead to cancer, but not all mutations do. Explain why and how some mutations can cause a cell to develop into a ca
ELEN [110]
Because of the medication that people put in their head so that they can cure cancer
7 0
3 years ago
Other questions:
  • The muscular tube near the mouth that aids in getting food is called the
    6·1 answer
  • What structures are found in every living cell
    10·2 answers
  • A student conducted an experiment to test the effect of the digestive enzyme pepsin on cooked egg white and potato in the presen
    6·1 answer
  • ______________ takes place when heat is transferred from one substance to another by direct contact. For example, imagine that y
    9·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Who painted the image above?
    14·1 answer
  • A bowling ball hitting pins and they fly backwards whicch <br> Newton’s law
    6·2 answers
  • ASAP!!! HELP.
    13·1 answer
  • What is a nucleotide? What is an amino acid? What is a simple sugar (glucose)? What do these three share in common?
    9·1 answer
  • Which molecule below will be moved across the cell membrane during osmosis?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!