1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
iris [78.8K]
3 years ago
10

Based on Figure 20–5, how can the student measure the effectiveness of each disinfectant?

Biology
1 answer:
koban [17]3 years ago
6 0
By elmulsifying it it
You might be interested in
USE PAPER TO MAKE YOUR PUNNETT SQUARE. In humans, black hair is
miv72 [106K]
Sorry for the handwriting

7 0
4 years ago
Definition of asteroid
Murrr4er [49]
A small rocky body orbiting the sun
5 0
3 years ago
Read 2 more answers
A student is conducting an experiment to determine how cold temperatures affect the growth of tadpoles in a tank of water. Which
timurjin [86]

Answer:

A

Explanation:

a calibrated bulb thermometer that has a readout from -15°C to 25°C

3 0
4 years ago
Read 2 more answers
Describe how natural selection can occur in a population. Choose an organism that you suspect has undergone natural selection, w
Ahat [919]

Following general conditions are necessary for natural selection to occur in population:

  • More organisms are born than can survive.
  • Organisms vary in their characteristics, even within a species.
  • Differences in reproduction and survival are due to variation among organisms.

According to Charles Darwin's theory of evolution by natural selection, organisms that possess heritable traits that enable them to better adapt to their environment compared with other members of their species will be more likely to survive, reproduce, and pass more of their genes on to the next generation.

Galapagos Finches: The Galapagos finches studied by Darwin on his famous voyage are probably the most common example of natural selection.

5 0
4 years ago
The bases of one of the strands of DNA in a region where DNA replication begins are shown here. What is the sequence of the prim
garik1379 [7]

Answer:

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

Explanation:

The synthesized primer will have base pair complementary to the given strand and also the leading and lagging ends will be opposite to the given strand.

As per the base pair rule for DNA

Guanine binds to cytosine & vice versa

Adenine always binds to thymine & vice versa

Given Sequence -                5' AGGCCTCGAATTCGTATAGCTTTCAGAAA 3'

Complementary primer-      3' TCCGGAGCTTAAGCATATCGAAAGTCTTT 5'

5 0
3 years ago
Other questions:
  • What is a rule describing a pattern in nature called
    15·2 answers
  • Which section of the heart receives deoxygenated blood? select one:
    7·1 answer
  • Increased levels of cortisol are associated with an infant's:
    12·1 answer
  • What percent of the motor cortex of the brain is devoted to the muscles of the hand?
    14·1 answer
  • True or false meiosis I is sexual reprodiction in eukartotes
    7·2 answers
  • sean notices two boys shoving another student in the hallway .the next day, he seen them doing the same thing
    14·1 answer
  • Pls help me for this <br> urgent ​
    5·2 answers
  • In an ecosystem, matter and something flow from one living thing to another
    10·1 answer
  • Is C2 considered a molecule or a compound?
    9·2 answers
  • What is the correct order of the following layers, from youngest to oldest?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!