1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Natasha2012 [34]
3 years ago
13

All animals are

Biology
1 answer:
ANEK [815]3 years ago
7 0

The correct answer is option a, that is, multicellular, heterotrophic, and diploid.  

Animals refer to the multicellular eukaryotic species, which forms the biological kingdom Animalia. Animals exhibit many features, which distinguish them from other living species. The animals are multicellular and eukaryotic, unlike prokaryotic bacteria, and unlike protists that are eukaryotic but unicellular.  

The animals are heterotrophic, not like algae and plants that generate their own food. Almost all the animals make use of some kind of sexual reproduction. They are diploid and generate haploid gametes by the process of meiosis, the larger non-motile gametes are ova and the smaller motile gametes are spermatozoa.  


You might be interested in
What are the SIX parts of a DNA molecule?\
alexdok [17]

Answer:

DNA is made up of six smaller molecules -- a five carbon sugar called deoxyribose, a phosphate molecule and four different nitrogenous bases (adenine, thymine, cytosine and guanine)

Explanation:

.

8 0
3 years ago
What evidence at the molecular level supports the theory of evolution
brilliants [131]

Answer:

Fossil Evidence and Structural evidence proves to support the theory of evolution because fossil evidence shows how animals looked like a few hundreds to thousands of years ago, and structural evidence shows how an animal can change from a land creature to a sea creator such as a whale starting from Indohyus to becoming a whale as it is now.

Read more on Brainly.com - brainly.com/question/11887816#readmore

Explanation:

8 0
3 years ago
Can someone please help me (you don’t have to do all of them ,just some)
allochka39001 [22]
Number 4 should be mitosis
3 0
3 years ago
Protein synthesis is a multistep process. put the steps of protein synthesis in sequential order.
wlad13 [49]

Answer:

Replication - Transcription - Translation

Explanation:

Replication duplicates the DNA so that happens first. Then in transcription converts the DNA to mRNA which goes to the cytoplasm to make proteins. In translation proteins are made when codons and anti codons join to make amino acids which create the proteins.

6 0
2 years ago
ASAP PLEASE
Nata [24]

Answer:

Explanation:

Not many organisms are able to live there. It would’ve extremely hard for an organism who is used to moderate temperature to inhabit an extremely cold habitat known for the extreme temperatures

Hope this helps

6 0
3 years ago
Other questions:
  • What kind of organism is used go produce human insulin?
    14·2 answers
  • When a person exercises, sensory input from moving muscles and joints results in an increase in cardiac output, causing blood pr
    6·2 answers
  • Plants are living organisms. What are some of the characteristics of life that plants must fulfill? Select all that apply.
    5·2 answers
  • The scientists who studied the plant life in an environment
    13·1 answer
  • Which feature is common to all planets<br> a core<br> b crust<br> c mantle
    9·2 answers
  • Brown hair is dominant over red hair. What will the genotypes and phenotypes of the offspring of a cross between a homozygous br
    7·1 answer
  • Help please, Please try to answer ASAP, Will give 10 points
    15·1 answer
  • HELP. Asap! Answer question in photo
    10·1 answer
  • Identify the joints that allow you to chew your favorite foods. A successful response will include: Structural AND functional cl
    8·1 answer
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!