1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
amm1812
3 years ago
13

In an experiment, Marlene removes the six anthers from the flower. What best describes the ability of the altered flower to form

seeds?
Biology
2 answers:
Anastasy [175]3 years ago
7 0

Answer:

This flower will not be able to produce seeds.

Explanation:

The anther is a structure composed of two teak (halves), is fertile and responsible for the production of pollen grains, pollen grains are responsible for the generation of seeds when it comes into contact with the ovary of another plant. Thus, if a flower loses all its anthers, it means that it will not be able to generate pollen and will not be able to produce seeds.

Still in the juvenile state the anther begins the production of pollen. Each teak has two pollen bags (cavities) lined with a layer of nutrients called “tapetum”. It is still in this juvenile phase that the mother cells of the pollen grains are found, resting in each pollen sac. The anther has an outer layer, the epidermis, and an inner layer, the endothecium.

Alik [6]3 years ago
3 0

Ans.

In flowering plants, the male reproductive part or stamen is made up of a stack-like structure, known as filament and an ovule-like structure, known as anther. In anthers, microsporangia are present that produce pollen through mitosis.

Thus, 'if anthers are removed from a flower, it will not be able to form seeds as seeds are developed from zygote, that forms by the fusion of male gamete (pollen) and female gamete (ovum).'

You might be interested in
What structures do sponges possess that may prevent other animals from eating them?
Nitella [24]

The answer is spicules. These sharp-pointed structures are formed from calcium carbonate skeleton of the organisms.  They can also be formed from silica. They can be big (megascleres), or microscopic (microscleres). Also dependent on the number of axis on the spicules, they are classified as monoaxon, triaxon or polyaxon.


8 0
3 years ago
Read 2 more answers
Type II topoisomerases display all of the following characteristics EXCEPT
Firlakuza [10]

Answer:

The correct answer is option A. "They only introduce supercoiling and cannot relax a covalently closed circular DNA".

Explanation:

Type II topoisomerases are enzymes that regulate the winding an unwinding of DNA during DNA replication. Basically, these enzymes are the scissor that remove the knots and tangles formed during the replication process. Is false to affirm that type II topoisomerases only introduce supercoiling and cannot relax a covalently closed circular DNA. Bacterial type II DNA topoisomerases  work with the circular DNA of bacterium by changing the linking number of circular DNA by ±2.

6 0
3 years ago
What is the mRNA in TACCGGATGCCAGATCAAATC?
Softa [21]

Answer:

AUGGCCUACGGUCUAGUUUAG

3 0
2 years ago
HELP ASAP!!! 20 POINTSS!!!!
bezimeni [28]

Answer:

It will slow the degradation of the ozone layer. Please tell me if this is correct. Thanks!

4 0
3 years ago
Read 2 more answers
Who wanna be my bsff i cant find my other one
Aliun [14]
Sure lol I’m bored either way ahahah
5 0
2 years ago
Read 2 more answers
Other questions:
  • Why is a convex mirror used to look under a vehicle during a security check?
    9·2 answers
  • Discuss 3 methods of passive transport
    8·2 answers
  • A gas can be squeezed into a smaller container, but a liquid cannot. What does this suggest about the arrangement of particles i
    5·1 answer
  • Which term is the type of catalysts that speed up chemical reactions in the human body? A) blood B) water C) urine D) enzymes
    15·2 answers
  • PLEASE! URGENT HELP ASAP!!! What happens to a hurricane when it moves onto land? Why?
    9·1 answer
  • According to the food web what would happen to the producers if a virusbroke out among the primary consumers and wiped out most
    11·1 answer
  • I need help ASAP marking braniiest
    5·1 answer
  • The structures responsible for completing the breakdown of carbohydrates into usable energy for the cell are the
    6·2 answers
  • How does energy first enter a pond ecosystem?
    9·2 answers
  • Which if the following is an example of a biotic factor?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!