1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alukav5142 [94]
3 years ago
5

What must happen before meiosis can begin

Biology
1 answer:
777dan777 [17]3 years ago
8 0
Before meiosis can begin, the DNA that is packaged into chromosomes must be fully copied. Hope that’s helps
You might be interested in
What does an ideal urchin environment would look like
Gwar [14]
Despite their frequency in the intertidal zone, in tide pools, sea urchins can be found at many different depths and in any habitats. They can also be found in nearly any ocean temperature. Sea urchins inhabit the polar seas as well as the warm tropics.
3 0
2 years ago
What genere of games involves gameplay that is designed to simulate real-world or fictionalized activities such as flying a plan
OLEGan [10]

Answer: The answer is Simulation Games

Explanation:

Simulation games are games that are designed to imitate or closely simulate real-world life activities. The players are able to control characters in the game, they are provided with a simulated environment in which they can play. The characters in the game copy real life activities such as flying a plane, managing a city as listed in the question, cooking, interacting with others, attending school or going to work, etc.

7 0
3 years ago
How do earth worms breath?
Lelechka [254]


Worms don't have lungs. They breathe through their skin.

Hope this helps.  :)

5 0
3 years ago
Read 2 more answers
help plzzz 2 more will mark brainlest. Changes to abiotic factors in an environment can impact biotic factors. Climate change ma
Sedaia [141]

Answer: Here are three reasons if they don't help just tell me.

1. Changes in water temperature can affect the environments where fish, shellfish, and other marine species live. As climate change causes the oceans to become warmer year-round, populations of some species may adapt by shifting toward cooler areas. Oceans are becoming more acidic. 2.  Oceans are becoming more acidic. The acidity of seawater is increasing as a direct result of increasing carbon dioxide levels in the air from human activities, like burning fossil fuels. Concentrations of carbon dioxide are higher than in the last 800,000 years. Carbon dioxide dissolves in water, changing seawater chemistry and decreasing pH (making seawater more acidic). The ocean’s increased acidity results in thinner shells and more shellfish die as they become easier for predators to eat. 3.  More severe storms and precipitation can pollute coastal waters. Warmer oceans increase the amount of water that evaporates into the air. When more moisture-laden air moves over land or converges into a storm system, it can produce more intense precipitation—for example, heavier rainstorms. Heavy rain in coastal areas can lead to increases in runoff and flooding, impairing water quality as pollutants on land wash into water bodies. Some coastal areas, such as the Gulf of Mexico and the Chesapeake Bay, are already experiencing “dead zones” – areas where water is depleted of oxygen because of pollution from agricultural fertilizers, delivered by runoff. The phrase “dead zone” comes from the lack of life – including fish – in these waters.

5 0
3 years ago
Why does natural selection act on the phenotypes rather than the genotype of an organism?
o-na [289]
This is why natural selection acts on phenotypes instead of genotypes. A phenotype is an organism's physical traits, while a genotype is an organism's genetic makeup. This may sound counter-intuitive since the genetic makeup does get<span> passed on from generation to generation through reproduction.</span>
5 0
2 years ago
Other questions:
  • What group of protein regulates cell division in eukaryotes
    10·1 answer
  • Which one of the following statements is true? Monocot stems have scattered vascular tissue, whereas eudicot stems have vascular
    9·2 answers
  • Organisms maintain dynamic homeostasis through behavioral and physiological mechanisms. Which of the following statements is an
    12·1 answer
  • Which energy conversion takes place in plant cells, but never in animal cells?
    8·1 answer
  • The buildup of charges on an object is called
    9·1 answer
  • Revisions to accepted scientific explanations can be based on what?
    8·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • The following DNA fragment was isolated from the beginning of a gene.
    9·1 answer
  • You are reading a science fiction novel about a biotechnologically advanced society where individuals must choose one of the fol
    13·1 answer
  • Which Behavior is a Response to an External Stimuli?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!