1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
maksim [4K]
3 years ago
12

Which of the following is not true of biotechnology? Biotechnology raises just as many concerns as it does benefits. Biotechnolo

gy is a new branch of science. Biotechnology is a huge part of life. Biotechnology raises ethical concerns.
Biology
1 answer:
Vesna [10]3 years ago
5 0

Answer:

Biotechnology is a new branch of science

Explanation:

The begining of biotechnology was somewhere around the 1920s i think so it is not old

You might be interested in
All the genetic material needed to grow a human is present in the
Volgvan

Answer:

C. the nuclei

Explanation:

All of our dna is stored in the nuclei.

4 0
3 years ago
Read 2 more answers
the series of molecules through which excited electrons are passed down thylakoid membrane is called ​
user100 [1]

Answer:

The series of molecules through which excited electrons are passed down thylakoid membrane is called electron​ transport chain.

In electron​ transport chain, the transfer of electron occurs from the element which loses electron to the element which receives electron through a membrane like structure called thylakoid membrane . This occurs in redox reaction means one atom is reduced i. e. gain electron and other is oxidized i. e. loses electron.

5 0
3 years ago
Membrane phospholipids have hydrophobic heads that face the center of the membrane and
zysi [14]

Answer: Option B. are able to drift about in the plasma membrane.

Explanation:

Membrane phospholipid are having a amphiphilic structure which contains a hydrophilic "head" consisting of a phosphate group and two hydrophobic fatty acid "tails" that are connected to a glycerol molecule.

In contact with water, membrane phospholipid hydrophobic tail avoid interaction with water molecules and allow to drift about in the plasma membrane. the hydrophilic heads line up against each other and forms lipid bi-layer that faces towards water.

The movement of membrane phospholipid forms the fluid mosaic model,in which lipid molecules act as solvent and proteins embedded in it. This allows the proteins and lipid to move across plasma membrane.

Hence, The structural property of membrane phospholipid makes them able to drift about in the plasma membrane

3 0
3 years ago
Help what is an ion a compound A.that contains two elements
dimulka [17.4K]

Answer:

b, the definition of an ion is a charged atom or molecule

6 0
3 years ago
Which reason best explains why bacteria are good at causing infections in other organisms
Sliva [168]
When bacteria enter your body through an opening (wound,nose,mouth) they reproduce very quickly.
5 0
1 year ago
Other questions:
  • What causes a star to shine brightly
    13·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • describe how the theory of evolution is supported by fossils, comparative anatomy, comparative embryology, biogeography, and mol
    11·1 answer
  • Please match the white blood cells with the statements that most accurately describe them to test your understanding of the beha
    12·1 answer
  • Which of these correctly distinguishes mitosis from meiosis?
    14·2 answers
  • Rosa has a vegetable garden. She places earthworms, which are decomposers, in the garden soil.
    7·2 answers
  • Glaciers pick up large rocks and carry them away. This is called _____.
    6·2 answers
  • What is the difference between RNA vs DNA<br><br> What is the similarities between RNA vs DNA
    7·2 answers
  • A Vaccine normally given to children against Tuberculosis​
    7·1 answer
  • Which hypothesis helps to explain why all organism share the same genetic code?
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!