1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alja [10]
3 years ago
10

What are the main idea of the cell theory?

Biology
2 answers:
miskamm [114]3 years ago
7 0
What are the main idea's of the cell theory? Well there are three, here are the three main cell theory idea's...

<span>1. All living things are composed of cells
</span>2. Cells are the basic units of structure and function in living things
<span>3. All cells are produced from other cells

Good luck and Happy Holidays!~ ^-^</span>
Annette [7]3 years ago
4 0
The three main ideas of cell theory are that:
<span>
1. All living things are made up of one or more cells. </span>

<span>2. Cells are the basic units of life in which activities of life occur. </span>

<span>3. Living cells come only from other existing and living cells. </span>
You might be interested in
Sociologically, "gender" and "sex" are interchangeable terms that have virtually the same meaning true or false
kozerog [31]

Answer:      

False.

Explanation:

4 0
3 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
ATP is the energy currency we use in our bodies. The energy that is released from ATP when it is broken down comes from the ____
muminat

Answer: Oxidation of Glucose,Glycolytic reactions

Explanation:

4 0
3 years ago
Which of the following is found in both prokaryotic and eukaryotic cells?
zzz [600]
DNA is the correct answer but next time put answer choices so that people can better answer your questions. Thanks!
5 0
3 years ago
Quade is studying for an exam, which will cover neurons and action potentials. He has drawn a diagram that shows the segments of
VMariaS [17]

Answer: positive sodium ions

Explanation:

This relates to the Action Potential which is what a nerve cell goes through when it needs to send information down the nerve cell to another cell and so on till it gets to the destination of the message.

The information is transmitted when the segments of the axon fire and when they do, positive sodium ions come in from outside the cell to the inside thereby making the inside positive. The previous segment would return to a resting potential when potassium ions which are negative, rush into the cell.

3 0
2 years ago
Other questions:
  • In the film Avengers: Infinity War the main villain, Thanos, wipes out half of the life in the universe. His rational for doing
    13·2 answers
  • Elephants are valued by some people because their tusks are made of ivory. Although it is illegal, people kill elephants, take t
    7·2 answers
  • Unlike New World monkeys, hominines 
    15·1 answer
  • What determines the genotype of an organism
    5·1 answer
  • Which basic need is a Fox meeting by feeding on berries
    10·1 answer
  • 5 On his voyage on the HMS Beagle, Darwin saw fossils of giant sloths whose bones resembled bones of living sloths, but were muc
    8·1 answer
  • How does the growth of antibiotic resistance in bacteria support the theory of evolution by natural selection?
    7·1 answer
  • What happens to sunlight in photosynthesis?
    14·2 answers
  • What process produced the sperm in the male flies and egg in the female flies
    11·1 answer
  • if random chromosome alignment already shuffles chromosomes around so the eggs and sperm get a good mix of some “mom” alleles an
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!