AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Answer: Oxidation of Glucose,Glycolytic reactions
Explanation:
DNA is the correct answer but next time put answer choices so that people can better answer your questions. Thanks!
Answer: positive sodium ions
Explanation:
This relates to the Action Potential which is what a nerve cell goes through when it needs to send information down the nerve cell to another cell and so on till it gets to the destination of the message.
The information is transmitted when the segments of the axon fire and when they do, positive sodium ions come in from outside the cell to the inside thereby making the inside positive. The previous segment would return to a resting potential when potassium ions which are negative, rush into the cell.