1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
3 years ago
11

Groups of cells working together forms

Biology
1 answer:
zalisa [80]3 years ago
4 0
A group of like or similar types of cells that work together form tissue.
You might be interested in
Which best describe fetus development?
d1i1m1o1n [39]

During the development of human, the fetus is prenatal human in between the embryonic state and during the birth. The stage of development of a fetus begins at the gestational age of eleven weeks. The fetal stage is recognized when an embryo develop to the point where the major body organs is present.

6 0
3 years ago
Help me pls!!!!!!!!!!!!
Shtirlitz [24]

Explanation:

i don't understand the part I

part II

Amino acid

Hydrocarbon

Protein

Deoxyribonucleic acid

Nucleotide

Photosynthesis

5 0
3 years ago
What is the meaning of life, based on the Hitchhikers Guide>>>>>
Artemon [7]
42 is the meaning of life
7 0
3 years ago
How is water involved in making NADPH and ATP?
brilliants [131]

Answer: The basic equation of photosynthesis is deceptively simple. Water and carbon dioxide combine to form carbohydrates and molecular oxygen. ... NADPH and ATP formed by the action of light then reduce carbon dioxide and convert it into 3-phosphoglycerate by a series of reactions called the Calvin cycle or the dark reactions.

Explanation:

7 0
3 years ago
I. Match the following.
dezoksy [38]

I.

1. a minus-charged particle of an atom..... Electrons

2. a neutral (no charge) particle found in the nucleus of an atom..... Neutrons

3. a positive-charged particle in the nucleus of an atom.... Protons

4. a system of comparing atomic masses to carbon.... Relative mass

II. The atomic number of an atom is equal to the number of Protons.

III. The atomic number is always equal to the atomic mass. False.

IV. Atomic mass minus atomic number =number if neutrons.

V. A proton in the nucleus of an atom has an electrical charge of: +ve (positive).

VI. The atomic number of calcium is 20. This number means that calcium has 20 protons. The atomic mass of calcium is 40. How many neutrons does calcium have?

Answer: No of neutrons = atomic mass-atomic number

No of neutrons= 40-20=20 neutrons.

VII. Helium has an atomic number of 2. This number also means that helium has 2 protons. The atomic mass of helium is 4. How many neutrons does helium have?

Answer: No of neutrons = atomic mass-atomic number

No of neutrons= 4-2=2 neutrons.

VIII. The relative atomic mass of a proton or neutron is 1.

IX. The relative atomic mass is always a mass that is compared to the element Corbon.

X. Name the three kinds of sub-atomic particles found in an atom: electron, proton and neutron

4 0
3 years ago
Other questions:
  • If a pharmacy chain sold 75 million 500mg tablets of aspirin, how many tons does this represent?
    11·1 answer
  • How does the tympanic membrane work?
    13·2 answers
  • A fruit fly is classified as a heterotroph because it is unable to do what
    13·1 answer
  • The density of gold is 19.3 g/cm3. What is the volume of a 13 g gold nugget? (Density: D = )
    11·2 answers
  • If there were more weeds what would happen to the rabbits?
    7·1 answer
  • 15 points to the people that answer this right. ( PLEASE ANSWER QUICKLY )
    11·2 answers
  • Original Strand: AAGTACGATCGATGCACATGCATGGCTACGC<br> Complementary Strand:
    6·1 answer
  • What are density-dependent factors? any examples?
    8·1 answer
  • Please answer the following statement:
    11·1 answer
  • 1. The location of two hikers is marked on the topographic map to the right as points F and H. What is the elevation of the camp
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!