1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
natka813 [3]
3 years ago
7

QUESTION 3

Biology
1 answer:
Effectus [21]3 years ago
7 0

Water falls from a reservoir through a channel to a turbine. The water turns the turbines, which allows the generator to make electricity

Explanation:

Hydroelectric power is generated from free falling water through a river channel.

The flow of water at a high speed creates water current and the kinetic energy of the water movement spins turbine attached with a generator. This produces a rotating energy which spins the generator and the coil inside.

The magnetic spinning of coiled wire inside the generator produces electric current which is then stored and transmitted through electric power grid lines to supply electric current.

You might be interested in
Which of these statements is true about autotrophs, but not heterotrophs?
natka813 [3]
The third one,
Autotrophs use a process called photosynthesis to make their food. In photosynthesis, autotrophs use energy from the sun to convert water from the soil and carbon dioxide from the air into a nutrient called glucose. Glucose is a type of sugar. The glucose gives plants energy. Plants also use glucose to make cellulose, a substance they use to grow and build cell walls.
7 0
3 years ago
Read 2 more answers
Place the following elements in order from MOST to LEAST reactive:
fgiga [73]
Carbon is 6
Iridium is 77
Helium is 2
Sulfur is 16 ( not sure)
Hydrogen is 1
So
Hydrogen
Helium
Carbon
Sulfur
Iridium
Sorry if I’m incorrect.
5 0
3 years ago
Difference between Ecological Succession and Degradation?
ryzh [129]
In primary succession, newly exposed or newly formed rock is colonized by living things for the first time. In secondary succession, an area that was previously occupied by living things is disturbed, then re-colonized following the disturbance.
5 0
3 years ago
Animals that possess homologous structures probably _____. see concept 26.2 (page 556) view available hint(s) animals that posse
Arte-miy333 [17]
I believe animals that possess homologous structures probably  evolved from the same ancestor. Homologous structures are similar because of common ancestry.  A homologous structure is an example of an organ or bone that appears in different animals, underlining anatomical commonalities demonstrating descent from  a common ancestor. 
8 0
3 years ago
If a TRNA had a AGC anticodon it could attach a
Contact [7]

A transference RNA (tRNA) is an adapter molecule that decodes a codon messenger RNA (mRNA) during the synthesis of a polypeptide chain. These molecules (tRNAs) play a fundamental role during translation.

  • If a tRNA had an AGC anticodon it could attach a codon having the sequence UCG.

  • During translation, tRNAs act at specific sites in a ribosome to synthesize a polypeptide chain (i.e., a protein) from an mRNA sequence.

  • The anticodon of the tRNA binds by base complementary to a triplet of nucleotides or 'codon' in the messenger RNA (mRNA) during protein synthesis (i.e., translation).

  • According to the base complementarity rules, in RNA, Adenine always pairs with Uracile (Thymine in DNA), whereas Guanine always pairs with Cytosine.

Learn more in:

brainly.com/question/10014731?referrer=searchResults

5 0
2 years ago
Other questions:
  • What do the “nodes” in a cladogram represent?
    15·2 answers
  • What procedure would prepare agencies for a flu pandemic?
    6·1 answer
  • How does the high specific heat of water help maintain the temperature of earth
    7·1 answer
  • What percent of guanine would it contain if thymine is 42%
    5·1 answer
  • Genetic engineering is the scientific process of changing the genome of an organism for specific purposes. Which genetically eng
    12·1 answer
  • 1.What changes occur to chemical bonds during a chemical reaction?
    6·1 answer
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • What three units make up a nucleotide?
    15·1 answer
  • The group that includes gorillas, chimpanzees, bonobos, and humans is called the
    8·2 answers
  • Which two organisms above belong to the same kingdom? <br><br> bird, green plant, shark, mushroom
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!