Soil profile is the description of the various layers that soil forms as they get buried underneath the surface of the earth.
Plant cells have a cell wall that is very rigid, which forces the cell to shape that way. Animal cells are round because they don’t have a cell wall only a plasma membrane
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
