1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonja [21]
3 years ago
9

Which is not a component of the plasma membrane?

Biology
1 answer:
ipn [44]3 years ago
6 0

Answer:

nucleic acid is not a component of the plasma membrane

Explanation:

Nucleic acid is a type of complex organic substance that is found in living cells and essential to all known forms of life.

You might be interested in
What is one distinct DISADVANTAGE of sexual reproduction?
Sergio [31]
I believe the best answer is C.
5 0
3 years ago
Read 2 more answers
A quantity must be divided by multiples of ten when converting from a larger unit to a smaller unit. Please select the best answ
zzz [600]

Answer: False

Explanation: You're supposed to have numerically more smaller units than bigger units, since a lot of these smaller units are combined to create a single larger unit.

5 0
3 years ago
Explain how the data supports your hypothesis.
Viktor [21]

Answer: It is verified by testing it. If the data supports the hypothesis, then we consider the hypothesis to be verified and true. If however, the data does not support the hypothesis or refutes it, then the hypothesis is in trouble, and we have to come up with a different hypothesis to explain the observations.

Explanation:

5 0
3 years ago
The analysis of total microbial genomes in an environment is called _________________________and the total microbial genomes in
Levart [38]

The analysis of total microbial genomes in an environment is called metagenomics and the total microbial genomes in an environment (or the total microbial community itself) is called a microbiome.

<h3><u>Explanation:</u></h3>

The study that is associated with the genetic materials that are obtained directly form the sample in an environment refers to the term Meta genomics or  ecogenomics or community genomics. It can be considered as the process through which the  meta genome is produced.

The genetic material of the microbes such as  fungi, bacteria, viruses and protozoa refers to microbiome. These microbes lives inside the body of humans. The weight may range upto 5 pounds for these microbiomes. Micorbiomes are the total number of micro genomes that are present in the environment.

5 0
3 years ago
Help,,,, I will give you the brainliest answer
mart [117]
I think it’s A... not sure! Because you have no A so maybe A
7 0
3 years ago
Other questions:
  • How do prokaryote, eukaryote and viruses differ?
    7·1 answer
  • How many chromosomes do both reproductive cells (gametes) *
    9·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • There are six elements that make up 99.9% of the human body. which one is responsible for most of the material found in teeth?
    6·1 answer
  • which macromolecules have a basic unit that is composed of phosphate, a sugar ring, and one of five different bases? a. proteins
    13·2 answers
  • What is the most efficient procedure that scientists can use to obtain more recombinant DNA for a particular trait?
    15·1 answer
  • During the last Ice Age, deer mice in Michigan became separated by a large glacial lake and are now two different species.
    12·1 answer
  • You are a scientist working in a research lab. You receive a new cell specimen that you
    14·1 answer
  • The carbon cycle is one of earth's natural resources that enables all living organisms to inhabit this planet. It is a vital res
    8·1 answer
  • Which would scientists predict might happen due to solar flares?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!